EMAIL THIS PAGE TO A FRIEND

ZNF770

zinc finger protein 770

Synonyms: PRO1914
UniProtKB ID: Q6IQ21, Q6ZMZ6, Q9NWV2
Gene ID:
Zebrafish(322785) zinc finger protein 770
Horse(100071735) zinc finger protein 770
domestic cat(101095104) zinc finger protein 770
chicken(423295) zinc finger protein 770
dog(100687020) zinc finger protein 770
cow(786537) zinc finger protein 770
sheep(101111809) zinc finger protein 770
domestic guinea pig(100726498) zinc finger protein 770
naked mole-rat(101724614) zinc finger protein 770
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014106 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110551 MISSION® esiRNA esiRNA human ZNF770 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014106 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173176 predicted 1865
2 SASI_Hs01_00173178 predicted 685
3 SASI_Hs01_00173180 predicted 2043
4 SASI_Hs01_00173181 predicted 1626
5 SASI_Hs02_00345114 predicted 732
6 SASI_Hs01_00173182 predicted 621
7 SASI_Hs02_00345115 predicted 726
8 SASI_Hs01_00173183 predicted 1333
9 SASI_Hs01_00173184 predicted 2349
10 SASI_Hs01_00173185 predicted 1448
11 SASI_Hs01_00173177 predicted 2265
12 SASI_Hs01_00173179 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014106
VALIDATED
ZNF770 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 770
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-518s21c1
Sequence:CCGGTCTGGAGAGGCATCAACTAACCTCGAGGTTAGTTGATGCCTCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-1160s1c1
Sequence:CCGGACTTGATGTCCACTCAATTTACTCGAGTAAATTGAGTGGACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-562s1c1
Sequence:CCGGGTATTTGTCAGCGTCACTTTACTCGAGTAAAGTGACGCTGACAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014106.2-2590s21c1
Sequence:CCGGACATGATTTGATGCTATAAAGCTCGAGCTTTATAGCATCAAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-1928s21c1
Sequence:CCGGTGGAAACTTCAACAATCTTTCCTCGAGGAAAGATTGTTGAAGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-997s21c1
Sequence:CCGGGCAAACTTCTGAAGCATAAACCTCGAGGTTTATGCTTCAGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-1744s21c1
Sequence:CCGGACAAATGTGAGAAGGTATTTCCTCGAGGAAATACCTTCTCACATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014106.2-2094s1c1
Sequence:CCGGCCCTGTCTTCCTAATGTACTTCTCGAGAAGTACATTAGGAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-3930s1c1
Sequence:CCGGCCGTTATGTTTCTAAGCTGAACTCGAGTTCAGCTTAGAAACATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014106.2-1022s1c1
Sequence:CCGGCCATACTAGGAATAAGGCTTTCTCGAGAAAGCCTTATTCCTAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014106.2-2472s1c1
Sequence:CCGGCCTGCATTAAACTGAATGGTTCTCGAGAACCATTCAGTTTAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014106.2-3391s1c1
Sequence:CCGGCCATGTTTACTTACCAGGAATCTCGAGATTCCTGGTAAGTAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014106.2-3327s1c1
Sequence:CCGGGCTAGTGCTATCTTTCTCAAACTCGAGTTTGAGAAAGATAGCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-4549s1c1
Sequence:CCGGGCTTGTATGATTCTGAGACTTCTCGAGAAGTCTCAGAATCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014106.2-413s1c1
Sequence:CCGGGCACTTTGAAACACCATCAAACTCGAGTTTGATGGTGTTTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014106
VALIDATED
ZNF770 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 770
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-518s21c1
Sequence:CCGGTCTGGAGAGGCATCAACTAACCTCGAGGTTAGTTGATGCCTCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-1160s1c1
Sequence:CCGGACTTGATGTCCACTCAATTTACTCGAGTAAATTGAGTGGACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-562s1c1
Sequence:CCGGGTATTTGTCAGCGTCACTTTACTCGAGTAAAGTGACGCTGACAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014106.2-2590s21c1
Sequence:CCGGACATGATTTGATGCTATAAAGCTCGAGCTTTATAGCATCAAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-1928s21c1
Sequence:CCGGTGGAAACTTCAACAATCTTTCCTCGAGGAAAGATTGTTGAAGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-997s21c1
Sequence:CCGGGCAAACTTCTGAAGCATAAACCTCGAGGTTTATGCTTCAGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-1744s21c1
Sequence:CCGGACAAATGTGAGAAGGTATTTCCTCGAGGAAATACCTTCTCACATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014106.2-2094s1c1
Sequence:CCGGCCCTGTCTTCCTAATGTACTTCTCGAGAAGTACATTAGGAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-3930s1c1
Sequence:CCGGCCGTTATGTTTCTAAGCTGAACTCGAGTTCAGCTTAGAAACATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014106.2-1022s1c1
Sequence:CCGGCCATACTAGGAATAAGGCTTTCTCGAGAAAGCCTTATTCCTAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014106.2-2472s1c1
Sequence:CCGGCCTGCATTAAACTGAATGGTTCTCGAGAACCATTCAGTTTAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014106.2-3391s1c1
Sequence:CCGGCCATGTTTACTTACCAGGAATCTCGAGATTCCTGGTAAGTAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014106.2-3327s1c1
Sequence:CCGGGCTAGTGCTATCTTTCTCAAACTCGAGTTTGAGAAAGATAGCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-4549s1c1
Sequence:CCGGGCTTGTATGATTCTGAGACTTCTCGAGAAGTCTCAGAATCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014106.2-413s1c1
Sequence:CCGGGCACTTTGAAACACCATCAAACTCGAGTTTGATGGTGTTTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014106
VALIDATED
ZNF770 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 770
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-518s21c1
Sequence:CCGGTCTGGAGAGGCATCAACTAACCTCGAGGTTAGTTGATGCCTCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-1160s1c1
Sequence:CCGGACTTGATGTCCACTCAATTTACTCGAGTAAATTGAGTGGACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-562s1c1
Sequence:CCGGGTATTTGTCAGCGTCACTTTACTCGAGTAAAGTGACGCTGACAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014106.2-2590s21c1
Sequence:CCGGACATGATTTGATGCTATAAAGCTCGAGCTTTATAGCATCAAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-1928s21c1
Sequence:CCGGTGGAAACTTCAACAATCTTTCCTCGAGGAAAGATTGTTGAAGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-997s21c1
Sequence:CCGGGCAAACTTCTGAAGCATAAACCTCGAGGTTTATGCTTCAGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014106.2-1744s21c1
Sequence:CCGGACAAATGTGAGAAGGTATTTCCTCGAGGAAATACCTTCTCACATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014106.2-2094s1c1
Sequence:CCGGCCCTGTCTTCCTAATGTACTTCTCGAGAAGTACATTAGGAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-3930s1c1
Sequence:CCGGCCGTTATGTTTCTAAGCTGAACTCGAGTTCAGCTTAGAAACATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014106.2-1022s1c1
Sequence:CCGGCCATACTAGGAATAAGGCTTTCTCGAGAAAGCCTTATTCCTAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014106.2-2472s1c1
Sequence:CCGGCCTGCATTAAACTGAATGGTTCTCGAGAACCATTCAGTTTAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014106.2-3391s1c1
Sequence:CCGGCCATGTTTACTTACCAGGAATCTCGAGATTCCTGGTAAGTAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014106.2-3327s1c1
Sequence:CCGGGCTAGTGCTATCTTTCTCAAACTCGAGTTTGAGAAAGATAGCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014106.2-4549s1c1
Sequence:CCGGGCTTGTATGATTCTGAGACTTCTCGAGAAGTCTCAGAATCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014106.2-413s1c1
Sequence:CCGGGCACTTTGAAACACCATCAAACTCGAGTTTGATGGTGTTTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks