EMAIL THIS PAGE TO A FRIEND

ZNF772

zinc finger protein 772

UniProtKB ID: Q68DY9, A6NJK9, B4DH56, B4DYS0
Gene ID:
Horse(100052796) zinc finger protein 772
Horse(100051250) zinc finger protein 772
domestic cat(101098836) zinc finger protein 772
dog(484262) zinc finger protein 772
sheep(101114551) zinc finger protein 772
naked mole-rat(101710310) zinc finger protein 772
Domestic Rabbit(100345124) zinc finger protein 772
domestic guinea pig(100718994) zinc finger protein 772
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024596 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024596 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197948 predicted 1425
2 SASI_Hs01_00197949 predicted 886
3 SASI_Hs01_00197950 predicted 1464
4 SASI_Hs01_00197951 predicted 1418
5 SASI_Hs01_00197952 predicted 848
6 SASI_Hs01_00197953 predicted 1468
7 SASI_Hs01_00197954 predicted 1157
8 SASI_Hs01_00197955 predicted 294
9 SASI_Hs01_00197956 predicted 770
10 SASI_Hs02_00307176 predicted 899
11 SASI_Hs01_00197947 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024596
ZNF772 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 772
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024596.1-5115s1c1
Sequence:CCGGGCCCAGAATATGGGCTATCTTCTCGAGAAGATAGCCCATATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-310s1c1
Sequence:CCGGGAAGTAATTGTGGACCCTATACTCGAGTATAGGGTCCACAATTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-890s1c1
Sequence:CCGGTGAACAACTGTGCTGTGCAATCTCGAGATTGCACAGCACAGTTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-1516s1c1
Sequence:CCGGTCTGACCTTATTGCACATCAACTCGAGTTGATGTGCAATAAGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-937s1c1
Sequence:CCGGGAGGCTTGTAAGGACTTCCTACTCGAGTAGGAAGTCCTTACAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024596.2-2181s21c1
Sequence:CCGGAGGTTTCCCTTCATGGATATACTCGAGTATATCCATGAAGGGAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024596.2-1602s21c1
Sequence:CCGGTGTACTTGTTCAGCATCATAGCTCGAGCTATGATGCTGAACAAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024596.2-1914s21c1
Sequence:CCGGTCTAGACTCTTGCTGGAATTTCTCGAGAAATTCCAGCAAGAGTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024596
ZNF772 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 772
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024596.1-5115s1c1
Sequence:CCGGGCCCAGAATATGGGCTATCTTCTCGAGAAGATAGCCCATATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-310s1c1
Sequence:CCGGGAAGTAATTGTGGACCCTATACTCGAGTATAGGGTCCACAATTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-890s1c1
Sequence:CCGGTGAACAACTGTGCTGTGCAATCTCGAGATTGCACAGCACAGTTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-1516s1c1
Sequence:CCGGTCTGACCTTATTGCACATCAACTCGAGTTGATGTGCAATAAGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-937s1c1
Sequence:CCGGGAGGCTTGTAAGGACTTCCTACTCGAGTAGGAAGTCCTTACAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024596.2-2181s21c1
Sequence:CCGGAGGTTTCCCTTCATGGATATACTCGAGTATATCCATGAAGGGAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024596.2-1602s21c1
Sequence:CCGGTGTACTTGTTCAGCATCATAGCTCGAGCTATGATGCTGAACAAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024596.2-1914s21c1
Sequence:CCGGTCTAGACTCTTGCTGGAATTTCTCGAGAAATTCCAGCAAGAGTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024596
ZNF772 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 772
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024596.1-5115s1c1
Sequence:CCGGGCCCAGAATATGGGCTATCTTCTCGAGAAGATAGCCCATATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-310s1c1
Sequence:CCGGGAAGTAATTGTGGACCCTATACTCGAGTATAGGGTCCACAATTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-890s1c1
Sequence:CCGGTGAACAACTGTGCTGTGCAATCTCGAGATTGCACAGCACAGTTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-1516s1c1
Sequence:CCGGTCTGACCTTATTGCACATCAACTCGAGTTGATGTGCAATAAGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024596.1-937s1c1
Sequence:CCGGGAGGCTTGTAAGGACTTCCTACTCGAGTAGGAAGTCCTTACAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024596.2-2181s21c1
Sequence:CCGGAGGTTTCCCTTCATGGATATACTCGAGTATATCCATGAAGGGAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024596.2-1602s21c1
Sequence:CCGGTGTACTTGTTCAGCATCATAGCTCGAGCTATGATGCTGAACAAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024596.2-1914s21c1
Sequence:CCGGTCTAGACTCTTGCTGGAATTTCTCGAGAAATTCCAGCAAGAGTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks