EMAIL THIS PAGE TO A FRIEND

ZNF773

zinc finger protein 773

Synonyms: ZNF419B
Species: Human ZNF773(374928)
UniProtKB ID: Q6PK81, Q96DL8
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198542 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198542 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205886 predicted 911
2 SASI_Hs01_00205887 predicted 804
3 SASI_Hs01_00205888 predicted 1466
4 SASI_Hs01_00205889 predicted 459
5 SASI_Hs01_00205890 predicted 1540
6 SASI_Hs01_00205891 predicted 1535
7 SASI_Hs01_00205892 predicted 1561
8 SASI_Hs01_00205893 predicted 1541
9 SASI_Hs01_00205885 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198542
ZNF773 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 773
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198542.1-1653s21c1
Sequence:CCGGACCGTATTCAACACCAGAAAGCTCGAGCTTTCTGGTGTTGAATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198542.1-1690s21c1
Sequence:CCGGGCCTTAGACTGTCGCTGAATCCTCGAGGATTCAGCGACAGTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-462s1c1
Sequence:CCGGCCAAGTTCAAACGTTCAGCAACTCGAGTTGCTGAACGTTTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-309s1c1
Sequence:CCGGGCATCTTCCAAGACCCATGAACTCGAGTTCATGGGTCTTGGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-1423s1c1
Sequence:CCGGCCAGTCTTGTTAAACATCGAACTCGAGTTCGATGTTTAACAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-802s1c1
Sequence:CCGGGCAGTGAATGTGGGAAGTTATCTCGAGATAACTTCCCACATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198542
ZNF773 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 773
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198542.1-1653s21c1
Sequence:CCGGACCGTATTCAACACCAGAAAGCTCGAGCTTTCTGGTGTTGAATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198542.1-1690s21c1
Sequence:CCGGGCCTTAGACTGTCGCTGAATCCTCGAGGATTCAGCGACAGTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-462s1c1
Sequence:CCGGCCAAGTTCAAACGTTCAGCAACTCGAGTTGCTGAACGTTTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-309s1c1
Sequence:CCGGGCATCTTCCAAGACCCATGAACTCGAGTTCATGGGTCTTGGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-1423s1c1
Sequence:CCGGCCAGTCTTGTTAAACATCGAACTCGAGTTCGATGTTTAACAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-802s1c1
Sequence:CCGGGCAGTGAATGTGGGAAGTTATCTCGAGATAACTTCCCACATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198542
ZNF773 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 773
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198542.1-1653s21c1
Sequence:CCGGACCGTATTCAACACCAGAAAGCTCGAGCTTTCTGGTGTTGAATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198542.1-1690s21c1
Sequence:CCGGGCCTTAGACTGTCGCTGAATCCTCGAGGATTCAGCGACAGTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-462s1c1
Sequence:CCGGCCAAGTTCAAACGTTCAGCAACTCGAGTTGCTGAACGTTTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-309s1c1
Sequence:CCGGGCATCTTCCAAGACCCATGAACTCGAGTTCATGGGTCTTGGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-1423s1c1
Sequence:CCGGCCAGTCTTGTTAAACATCGAACTCGAGTTCGATGTTTAACAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198542.1-802s1c1
Sequence:CCGGGCAGTGAATGTGGGAAGTTATCTCGAGATAACTTCCCACATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks