EMAIL THIS PAGE TO A FRIEND

ZNF774

zinc finger protein 774

UniProtKB ID: Q6NX45, A8K020
Gene ID:
dog(488748) zinc finger protein 774
domestic cat(101087580) zinc finger protein 774
Horse(100068691) zinc finger protein 774
naked mole-rat(101720796) zinc finger protein 774
cow(100125278) zinc finger protein 774
sheep(101107821) zinc finger protein 774
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004309 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155431 MISSION® esiRNA esiRNA human ZNF774 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004309 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199156 predicted 1516
2 SASI_Hs01_00199157 predicted 931
3 SASI_Hs01_00199158 predicted 660
4 SASI_Hs02_00304513 predicted 207
5 SASI_Hs01_00199160 predicted 1352
6 SASI_Hs01_00199161 predicted 1259
7 SASI_Hs02_00304514 predicted 423
8 SASI_Hs01_00199162 predicted 1435
9 SASI_Hs01_00199164 predicted 925
10 SASI_Hs01_00199165 predicted 882
11 SASI_Hs01_00199159 predicted 1357
12 SASI_Hs01_00199163 predicted 1361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004309
ZNF774 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 774
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004309.1-1614s1c1
Sequence:CCGGCATTGCTACTGTCTTCAAGCACTCGAGTGCTTGAAGACAGTAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-191s1c1
Sequence:CCGGCACCCAGCACAGTTAGAAGAACTCGAGTTCTTCTAACTGTGCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-772s1c1
Sequence:CCGGCGACAGCTCAACACTCATCAACTCGAGTTGATGAGTGTTGAGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-612s1c1
Sequence:CCGGCCTATCTCATAAGACACCTAACTCGAGTTAGGTGTCTTATGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-155s1c1
Sequence:CCGGCCTGGACACTGCTTAGAGAATCTCGAGATTCTCTAAGCAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004309
ZNF774 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 774
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004309.1-1614s1c1
Sequence:CCGGCATTGCTACTGTCTTCAAGCACTCGAGTGCTTGAAGACAGTAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-191s1c1
Sequence:CCGGCACCCAGCACAGTTAGAAGAACTCGAGTTCTTCTAACTGTGCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-772s1c1
Sequence:CCGGCGACAGCTCAACACTCATCAACTCGAGTTGATGAGTGTTGAGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-612s1c1
Sequence:CCGGCCTATCTCATAAGACACCTAACTCGAGTTAGGTGTCTTATGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-155s1c1
Sequence:CCGGCCTGGACACTGCTTAGAGAATCTCGAGATTCTCTAAGCAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004309
ZNF774 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 774
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004309.1-1614s1c1
Sequence:CCGGCATTGCTACTGTCTTCAAGCACTCGAGTGCTTGAAGACAGTAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-191s1c1
Sequence:CCGGCACCCAGCACAGTTAGAAGAACTCGAGTTCTTCTAACTGTGCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-772s1c1
Sequence:CCGGCGACAGCTCAACACTCATCAACTCGAGTTGATGAGTGTTGAGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-612s1c1
Sequence:CCGGCCTATCTCATAAGACACCTAACTCGAGTTAGGTGTCTTATGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004309.1-155s1c1
Sequence:CCGGCCTGGACACTGCTTAGAGAATCTCGAGATTCTCTAAGCAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks