EMAIL THIS PAGE TO A FRIEND

ZNF775

zinc finger protein 775

UniProtKB ID: Q96BV0, Q8IY24
Gene ID:
cow(788568) zinc finger protein 775
domestic guinea pig(100732016) zinc finger protein 775
domestic cat(101093594) zinc finger protein 775
dog(100686819) zinc finger protein 775
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102959 Anti-ZNF775 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB2103274 Anti-ZNF775, (N-terminal) antibody produced in rabbit affinity isolated antibody human, bovine, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173680 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063571 MISSION® esiRNA esiRNA human ZNF775 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173680 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368616 predicted 216
2 SASI_Hs02_00368617 predicted 421
3 SASI_Hs02_00368618 predicted 234
4 SASI_Hs02_00368619 predicted 318
5 SASI_Hs02_00368620 predicted 473
6 SASI_Hs02_00368621 predicted 421
7 SASI_Hs02_00368622 predicted 435
8 SASI_Hs01_00230474 predicted 429
9 SASI_Hs02_00368623 predicted 426
10 SASI_Hs01_00230476 predicted 548
11 SASI_Hs01_00230472 predicted 491
12 SASI_Hs01_00230473 predicted 1411
13 SASI_Hs01_00230475 predicted 401
14 SASI_Hs01_00230477 predicted 2116
15 SASI_Hs01_00230478 predicted 1854
16 SASI_Hs01_00230479 predicted 1838
17 SASI_Hs01_00230480 predicted 2014
18 SASI_Hs01_00230481 predicted 1924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173680
ZNF775 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 775
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173680.2-1840s1c1
Sequence:CCGGCAGTTCTAGAAGCGTCCCAAACTCGAGTTTGGGACGCTTCTAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-395s1c1
Sequence:CCGGGTCACTTTGTATGCCTGGACTCTCGAGAGTCCAGGCATACAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-920s1c1
Sequence:CCGGCAGTTCATCTGCAACGAGTGTCTCGAGACACTCGTTGCAGATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-1045s1c1
Sequence:CCGGGCCCAACTTGACGCGGCACCTCTCGAGAGGTGCCGCGTCAAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-386s1c1
Sequence:CCGGCCGGCGAGGGTCACTTTGTATCTCGAGATACAAAGTGACCCTCGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173680
ZNF775 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 775
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173680.2-1840s1c1
Sequence:CCGGCAGTTCTAGAAGCGTCCCAAACTCGAGTTTGGGACGCTTCTAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-395s1c1
Sequence:CCGGGTCACTTTGTATGCCTGGACTCTCGAGAGTCCAGGCATACAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-920s1c1
Sequence:CCGGCAGTTCATCTGCAACGAGTGTCTCGAGACACTCGTTGCAGATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-1045s1c1
Sequence:CCGGGCCCAACTTGACGCGGCACCTCTCGAGAGGTGCCGCGTCAAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-386s1c1
Sequence:CCGGCCGGCGAGGGTCACTTTGTATCTCGAGATACAAAGTGACCCTCGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173680
ZNF775 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 775
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173680.2-1840s1c1
Sequence:CCGGCAGTTCTAGAAGCGTCCCAAACTCGAGTTTGGGACGCTTCTAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-395s1c1
Sequence:CCGGGTCACTTTGTATGCCTGGACTCTCGAGAGTCCAGGCATACAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-920s1c1
Sequence:CCGGCAGTTCATCTGCAACGAGTGTCTCGAGACACTCGTTGCAGATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-1045s1c1
Sequence:CCGGGCCCAACTTGACGCGGCACCTCTCGAGAGGTGCCGCGTCAAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173680.2-386s1c1
Sequence:CCGGCCGGCGAGGGTCACTTTGTATCTCGAGATACAAAGTGACCCTCGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks