EMAIL THIS PAGE TO A FRIEND

ZNF776

zinc finger protein 776

Species: Human ZNF776(284309)
UniProtKB ID: Q68DI1, Q6ZS36, Q8N968
Gene ID:
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173632 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173632 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167766 predicted 966
2 SASI_Hs01_00167767 predicted 1531
3 SASI_Hs01_00167768 predicted 1492
4 SASI_Hs01_00167769 predicted 547
5 SASI_Hs01_00167771 predicted 1076
6 SASI_Hs01_00167772 predicted 554
7 SASI_Hs01_00167773 predicted 967
8 SASI_Hs01_00167774 predicted 582
9 SASI_Hs01_00167775 predicted 1073
10 SASI_Hs02_00368513 predicted 1325
11 SASI_Hs01_00167770 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173632
VALIDATED
ZNF776 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 776
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-485s1c1
Sequence:CCGGCTTTGAAACTAAGCATGGGATCTCGAGATCCCATGCTTAGTTTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-706s1c1
Sequence:CCGGGTGGACAATGTGATGAATCATCTCGAGATGATTCATCACATTGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173632.2-1441s1c1
Sequence:CCGGCGGGAGAAAGACATCATGAATCTCGAGATTCATGATGTCTTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-340s1c1
Sequence:CCGGGCAATGCCAAGGGAACATCTTCTCGAGAAGATGTTCCCTTGGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-282s1c1
Sequence:CCGGGACGATGCAAACCATCATCAACTCGAGTTGATGATGGTTTGCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-383s21c1
Sequence:CCGGTATGTCACATGAGCCATTTATCTCGAGATAAATGGCTCATGTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-541s21c1
Sequence:CCGGGAGAGTCCACAATACCGTTTACTCGAGTAAACGGTATTGTGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173632.2-3584s21c1
Sequence:CCGGGGATAGTGTCCTACGTTATAACTCGAGTTATAACGTAGGACACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-1044s21c1
Sequence:CCGGACGGCATGTGGGAAGTTATTTCTCGAGAAATAACTTCCCACATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-708s21c1
Sequence:CCGGGGACAATGTGATGAATCATTTCTCGAGAAATGATTCATCACATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173632
VALIDATED
ZNF776 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 776
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-485s1c1
Sequence:CCGGCTTTGAAACTAAGCATGGGATCTCGAGATCCCATGCTTAGTTTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-706s1c1
Sequence:CCGGGTGGACAATGTGATGAATCATCTCGAGATGATTCATCACATTGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173632.2-1441s1c1
Sequence:CCGGCGGGAGAAAGACATCATGAATCTCGAGATTCATGATGTCTTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-340s1c1
Sequence:CCGGGCAATGCCAAGGGAACATCTTCTCGAGAAGATGTTCCCTTGGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-282s1c1
Sequence:CCGGGACGATGCAAACCATCATCAACTCGAGTTGATGATGGTTTGCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-383s21c1
Sequence:CCGGTATGTCACATGAGCCATTTATCTCGAGATAAATGGCTCATGTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-541s21c1
Sequence:CCGGGAGAGTCCACAATACCGTTTACTCGAGTAAACGGTATTGTGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173632.2-3584s21c1
Sequence:CCGGGGATAGTGTCCTACGTTATAACTCGAGTTATAACGTAGGACACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-1044s21c1
Sequence:CCGGACGGCATGTGGGAAGTTATTTCTCGAGAAATAACTTCCCACATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-708s21c1
Sequence:CCGGGGACAATGTGATGAATCATTTCTCGAGAAATGATTCATCACATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173632
VALIDATED
ZNF776 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 776
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-485s1c1
Sequence:CCGGCTTTGAAACTAAGCATGGGATCTCGAGATCCCATGCTTAGTTTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-706s1c1
Sequence:CCGGGTGGACAATGTGATGAATCATCTCGAGATGATTCATCACATTGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173632.2-1441s1c1
Sequence:CCGGCGGGAGAAAGACATCATGAATCTCGAGATTCATGATGTCTTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-340s1c1
Sequence:CCGGGCAATGCCAAGGGAACATCTTCTCGAGAAGATGTTCCCTTGGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173632.2-282s1c1
Sequence:CCGGGACGATGCAAACCATCATCAACTCGAGTTGATGATGGTTTGCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-383s21c1
Sequence:CCGGTATGTCACATGAGCCATTTATCTCGAGATAAATGGCTCATGTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-541s21c1
Sequence:CCGGGAGAGTCCACAATACCGTTTACTCGAGTAAACGGTATTGTGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173632.2-3584s21c1
Sequence:CCGGGGATAGTGTCCTACGTTATAACTCGAGTTATAACGTAGGACACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-1044s21c1
Sequence:CCGGACGGCATGTGGGAAGTTATTTCTCGAGAAATAACTTCCCACATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173632.2-708s21c1
Sequence:CCGGGGACAATGTGATGAATCATTTCTCGAGAAATGATTCATCACATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks