EMAIL THIS PAGE TO A FRIEND

ZNF777

zinc finger protein 777

UniProtKB ID: Q9ULD5, Q8N2R2, Q8N659
Gene ID:
domestic cat(101089846) zinc finger protein 777
Horse(100061348) zinc finger protein 777
dog(482786) zinc finger protein 777
domestic guinea pig(100716753) zinc finger protein 777
naked mole-rat(101719897) zinc finger protein 777
Domestic Rabbit(100352495) zinc finger protein 777
cow(517496) zinc finger protein 777
sheep(101121510) zinc finger protein 777
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015694 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123341 MISSION® esiRNA esiRNA human ZNF777 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015348 predicted 1896
2 SASI_Hs02_00348351 predicted 1901
3 SASI_Hs02_00348352 predicted 1002
4 SASI_Hs01_00015349 predicted 1247
5 SASI_Hs02_00348353 predicted 1123
6 SASI_Hs01_00015351 predicted 1245
7 SASI_Hs01_00015352 predicted 1897
8 SASI_Hs02_00348354 predicted 356
9 SASI_Hs02_00348355 predicted 411
10 SASI_Hs02_00348356 predicted 1290
11 SASI_Hs01_00015350 predicted 925
12 SASI_Hs01_00015353 predicted 386
13 SASI_Hs01_00015354 predicted 293
14 SASI_Hs01_00015355 predicted 366
15 SASI_Hs01_00015356 predicted 203
16 SASI_Hs01_00015357 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015694
VALIDATED
ZNF777 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 777
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015694.2-2922s21c1
Sequence:CCGGTGGATGAAACCAATCAGCACGCTCGAGCGTGCTGATTGGTTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-204s21c1
Sequence:CCGGTTCCACAAGAAGAAACCTTACCTCGAGGTAAGGTTTCTTCTTGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-1153s21c1
Sequence:CCGGACCAGACCTCATGTCACAGATCTCGAGATCTGTGACATGAGGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-258s21c1
Sequence:CCGGTGTTCCAATCCCGCGTTCTTCCTCGAGGAAGAACGCGGGATTGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-1129s21c1
Sequence:CCGGTTCCATGGACTATGCAATTTCCTCGAGGAAATTGCATAGTCCATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-2190s21c1
Sequence:CCGGACATCAGCTTGGTGATCCATCCTCGAGGATGGATCACCAAGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-819s21c1
Sequence:CCGGAGATAGCCGACTGCGAGAAGACTCGAGTCTTCTCGCAGTCGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-352s1c1
Sequence:CCGGCGATGGGATCGTGATTAAGATCTCGAGATCTTAATCACGATCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-697s1c1
Sequence:CCGGCGGGAGATATGAGGCCAGTATCTCGAGATACTGGCCTCATATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_015694.1-925s1c1
Sequence:CCGGCCGCCTGAAGATCAACCTCATCTCGAGATGAGGTTGATCTTCAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-80s1c1
Sequence:CCGGCCCGGCAGCAATGGAGAAGTTCTCGAGAACTTCTCCATTGCTGCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_015694.1-1487s1c1
Sequence:CCGGGCTGTTAATTTCCTTGACAATCTCGAGATTGTCAAGGAAATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015694
VALIDATED
ZNF777 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 777
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015694.2-2922s21c1
Sequence:CCGGTGGATGAAACCAATCAGCACGCTCGAGCGTGCTGATTGGTTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-204s21c1
Sequence:CCGGTTCCACAAGAAGAAACCTTACCTCGAGGTAAGGTTTCTTCTTGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-1153s21c1
Sequence:CCGGACCAGACCTCATGTCACAGATCTCGAGATCTGTGACATGAGGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-258s21c1
Sequence:CCGGTGTTCCAATCCCGCGTTCTTCCTCGAGGAAGAACGCGGGATTGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-1129s21c1
Sequence:CCGGTTCCATGGACTATGCAATTTCCTCGAGGAAATTGCATAGTCCATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-2190s21c1
Sequence:CCGGACATCAGCTTGGTGATCCATCCTCGAGGATGGATCACCAAGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-819s21c1
Sequence:CCGGAGATAGCCGACTGCGAGAAGACTCGAGTCTTCTCGCAGTCGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-352s1c1
Sequence:CCGGCGATGGGATCGTGATTAAGATCTCGAGATCTTAATCACGATCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-697s1c1
Sequence:CCGGCGGGAGATATGAGGCCAGTATCTCGAGATACTGGCCTCATATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_015694.1-925s1c1
Sequence:CCGGCCGCCTGAAGATCAACCTCATCTCGAGATGAGGTTGATCTTCAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-80s1c1
Sequence:CCGGCCCGGCAGCAATGGAGAAGTTCTCGAGAACTTCTCCATTGCTGCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_015694.1-1487s1c1
Sequence:CCGGGCTGTTAATTTCCTTGACAATCTCGAGATTGTCAAGGAAATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015694
VALIDATED
ZNF777 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 777
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015694.2-2922s21c1
Sequence:CCGGTGGATGAAACCAATCAGCACGCTCGAGCGTGCTGATTGGTTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-204s21c1
Sequence:CCGGTTCCACAAGAAGAAACCTTACCTCGAGGTAAGGTTTCTTCTTGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-1153s21c1
Sequence:CCGGACCAGACCTCATGTCACAGATCTCGAGATCTGTGACATGAGGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-258s21c1
Sequence:CCGGTGTTCCAATCCCGCGTTCTTCCTCGAGGAAGAACGCGGGATTGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-1129s21c1
Sequence:CCGGTTCCATGGACTATGCAATTTCCTCGAGGAAATTGCATAGTCCATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-2190s21c1
Sequence:CCGGACATCAGCTTGGTGATCCATCCTCGAGGATGGATCACCAAGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015694.2-819s21c1
Sequence:CCGGAGATAGCCGACTGCGAGAAGACTCGAGTCTTCTCGCAGTCGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-352s1c1
Sequence:CCGGCGATGGGATCGTGATTAAGATCTCGAGATCTTAATCACGATCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-697s1c1
Sequence:CCGGCGGGAGATATGAGGCCAGTATCTCGAGATACTGGCCTCATATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_015694.1-925s1c1
Sequence:CCGGCCGCCTGAAGATCAACCTCATCTCGAGATGAGGTTGATCTTCAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015694.1-80s1c1
Sequence:CCGGCCCGGCAGCAATGGAGAAGTTCTCGAGAACTTCTCCATTGCTGCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_015694.1-1487s1c1
Sequence:CCGGGCTGTTAATTTCCTTGACAATCTCGAGATTGTCAAGGAAATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks