EMAIL THIS PAGE TO A FRIEND

ZNF778

zinc finger protein 778

Species: Human ZNF778(197320), naked mole-rat Znf778(101704318)
UniProtKB ID: Q96MU6, Q08AG0
Gene ID:
Human(197320) Summary: The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011]
naked mole-rat(101704318) zinc finger protein 778
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182531 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182531 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370626 predicted 2040
2 SASI_Hs02_00370627 predicted 1508
3 SASI_Hs02_00370628 predicted 1961
4 SASI_Hs01_00120927 predicted 1175
5 SASI_Hs01_00120926 predicted 1473
6 SASI_Hs01_00120928 predicted 574
7 SASI_Hs01_00120929 predicted 1430
8 SASI_Hs02_00370629 predicted 1878
9 SASI_Hs02_00370630 predicted 2220
10 SASI_Hs01_00120934 predicted 609
11 SASI_Hs01_00120930 predicted 761
12 SASI_Hs01_00120931 predicted 770
13 SASI_Hs01_00120932 predicted 668
14 SASI_Hs01_00120933 predicted 1171
15 SASI_Hs01_00120935 predicted 1590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182531
ZNF778 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 778
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-1300s1c1
Sequence:CCGGGTCTTTCTAAACACGTCCAAACTCGAGTTTGGACGTGTTTAGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-568s1c1
Sequence:CCGGCCTCAGTAGAATGGCGACTTACTCGAGTAAGTCGCCATTCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182531.1-2166s1c1
Sequence:CCGGCCGGTGAGAAACCCTACATATCTCGAGATATGTAGGGTTTCTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-1468s1c1
Sequence:CCGGGCCTTAATAATCATGTTCGAACTCGAGTTCGAACATGATTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-567s1c1
Sequence:CCGGGCCTCAGTAGAATGGCGACTTCTCGAGAAGTCGCCATTCTACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182531.2-1967s21c1
Sequence:CCGGGAAATTCCTCGTGCCTGAATACTCGAGTATTCAGGCACGAGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182531
ZNF778 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 778
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-1300s1c1
Sequence:CCGGGTCTTTCTAAACACGTCCAAACTCGAGTTTGGACGTGTTTAGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-568s1c1
Sequence:CCGGCCTCAGTAGAATGGCGACTTACTCGAGTAAGTCGCCATTCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182531.1-2166s1c1
Sequence:CCGGCCGGTGAGAAACCCTACATATCTCGAGATATGTAGGGTTTCTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-1468s1c1
Sequence:CCGGGCCTTAATAATCATGTTCGAACTCGAGTTCGAACATGATTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-567s1c1
Sequence:CCGGGCCTCAGTAGAATGGCGACTTCTCGAGAAGTCGCCATTCTACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182531.2-1967s21c1
Sequence:CCGGGAAATTCCTCGTGCCTGAATACTCGAGTATTCAGGCACGAGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182531
ZNF778 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 778
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-1300s1c1
Sequence:CCGGGTCTTTCTAAACACGTCCAAACTCGAGTTTGGACGTGTTTAGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-568s1c1
Sequence:CCGGCCTCAGTAGAATGGCGACTTACTCGAGTAAGTCGCCATTCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182531.1-2166s1c1
Sequence:CCGGCCGGTGAGAAACCCTACATATCTCGAGATATGTAGGGTTTCTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-1468s1c1
Sequence:CCGGGCCTTAATAATCATGTTCGAACTCGAGTTCGAACATGATTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182531.1-567s1c1
Sequence:CCGGGCCTCAGTAGAATGGCGACTTCTCGAGAAGTCGCCATTCTACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182531.2-1967s21c1
Sequence:CCGGGAAATTCCTCGTGCCTGAATACTCGAGTATTCAGGCACGAGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks