EMAIL THIS PAGE TO A FRIEND

ZNF77

zinc finger protein 77

Synonyms: pT1
UniProtKB ID: Q15935, Q86XJ3, Q9NPP0
Gene ID:
cow(100849459) zinc finger protein 77
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021217 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113191 MISSION® esiRNA esiRNA human ZNF77 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021217 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020561 predicted 1306
2 SASI_Hs01_00020562 predicted 1811
3 SASI_Hs02_00354829 predicted 1103
4 SASI_Hs01_00020563 predicted 254
5 SASI_Hs01_00020564 predicted 1304
6 SASI_Hs01_00020566 predicted 538
7 SASI_Hs01_00020567 predicted 1048
8 SASI_Hs01_00020568 predicted 1716
9 SASI_Hs01_00020569 predicted 889
10 SASI_Hs01_00020570 predicted 1056
11 SASI_Hs01_00020565 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021217
VALIDATED
ZNF77 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 77
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021217.1-1774s1c1
Sequence:CCGGCCTTGTTGTAAATGTGAGAAACTCGAGTTTCTCACATTTACAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-930s1c1
Sequence:CCGGCCCTCGTACTTTCGAGAACATCTCGAGATGTTCTCGAAAGTACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_021217.1-213s1c1
Sequence:CCGGGCCTCCTTGGATTGTTACATTCTCGAGAATGTAACAATCCAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-317s1c1
Sequence:CCGGAGGAAGTGATTCCTGGTCTATCTCGAGATAGACCAGGAATCACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-684s1c1
Sequence:CCGGGCATCTGTGACATACGTGAAACTCGAGTTTCACGTATGTCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-1297s21c1
Sequence:CCGGTCGGATGTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGACATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-571s21c1
Sequence:CCGGGTGGCAAAGCCTTCGAGAATCCTCGAGGATTCTCGAAGGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-531s21c1
Sequence:CCGGAGTTACCCTACCGAAGCTAAACTCGAGTTTAGCTTCGGTAGGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021217.2-1820s21c1
Sequence:CCGGGTAAATGTGAGAAACGTTATTCTCGAGAATAACGTTTCTCACATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-606s21c1
Sequence:CCGGACTGGACAGAGACCGTGTAAGCTCGAGCTTACACGGTCTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021217
VALIDATED
ZNF77 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 77
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021217.1-1774s1c1
Sequence:CCGGCCTTGTTGTAAATGTGAGAAACTCGAGTTTCTCACATTTACAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-930s1c1
Sequence:CCGGCCCTCGTACTTTCGAGAACATCTCGAGATGTTCTCGAAAGTACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_021217.1-213s1c1
Sequence:CCGGGCCTCCTTGGATTGTTACATTCTCGAGAATGTAACAATCCAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-317s1c1
Sequence:CCGGAGGAAGTGATTCCTGGTCTATCTCGAGATAGACCAGGAATCACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-684s1c1
Sequence:CCGGGCATCTGTGACATACGTGAAACTCGAGTTTCACGTATGTCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-1297s21c1
Sequence:CCGGTCGGATGTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGACATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-571s21c1
Sequence:CCGGGTGGCAAAGCCTTCGAGAATCCTCGAGGATTCTCGAAGGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-531s21c1
Sequence:CCGGAGTTACCCTACCGAAGCTAAACTCGAGTTTAGCTTCGGTAGGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021217.2-1820s21c1
Sequence:CCGGGTAAATGTGAGAAACGTTATTCTCGAGAATAACGTTTCTCACATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-606s21c1
Sequence:CCGGACTGGACAGAGACCGTGTAAGCTCGAGCTTACACGGTCTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021217
VALIDATED
ZNF77 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 77
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021217.1-1774s1c1
Sequence:CCGGCCTTGTTGTAAATGTGAGAAACTCGAGTTTCTCACATTTACAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-930s1c1
Sequence:CCGGCCCTCGTACTTTCGAGAACATCTCGAGATGTTCTCGAAAGTACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_021217.1-213s1c1
Sequence:CCGGGCCTCCTTGGATTGTTACATTCTCGAGAATGTAACAATCCAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-317s1c1
Sequence:CCGGAGGAAGTGATTCCTGGTCTATCTCGAGATAGACCAGGAATCACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021217.1-684s1c1
Sequence:CCGGGCATCTGTGACATACGTGAAACTCGAGTTTCACGTATGTCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-1297s21c1
Sequence:CCGGTCGGATGTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGACATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-571s21c1
Sequence:CCGGGTGGCAAAGCCTTCGAGAATCCTCGAGGATTCTCGAAGGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-531s21c1
Sequence:CCGGAGTTACCCTACCGAAGCTAAACTCGAGTTTAGCTTCGGTAGGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021217.2-1820s21c1
Sequence:CCGGGTAAATGTGAGAAACGTTATTCTCGAGAATAACGTTTCTCACATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021217.2-606s21c1
Sequence:CCGGACTGGACAGAGACCGTGTAAGCTCGAGCTTACACGGTCTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks