EMAIL THIS PAGE TO A FRIEND

ZNF780A

zinc finger protein 780A

Synonyms: ZNF780
Species: Human ZNF780A(284323)
UniProtKB ID: O75290, E9PB48, Q6ZN87
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010880 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107411 MISSION® esiRNA esiRNA human ZNF780A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010880 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102087 predicted 282
2 SASI_Hs01_00102088 predicted 574
3 SASI_Hs01_00102089 predicted 363
4 SASI_Hs01_00102090 predicted 584
5 SASI_Hs01_00102092 predicted 296
6 SASI_Hs01_00102093 predicted 1277
7 SASI_Hs01_00102094 predicted 291
8 SASI_Hs01_00102091 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010880
ZNF780A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 780A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010880.2-830s21c1
Sequence:CCGGTTCGACTTCACATACAATTTACTCGAGTAAATTGTATGTGAAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010880.2-1596s21c1
Sequence:CCGGTTGCCAACTTATTGAACATTCCTCGAGGAATGTTCAATAAGTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-121s1c1
Sequence:CCGGCGGTATCCAGATTTGGAGTTACTCGAGTAACTCCAAATCTGGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-797s1c1
Sequence:CCGGCCAATGAGAAACCCTTTGTATCTCGAGATACAAAGGGTTTCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-595s1c1
Sequence:CCGGCTTACCCTGCTTAATCGCCATCTCGAGATGGCGATTAAGCAGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-373s1c1
Sequence:CCGGTGCAATACACATAAACCGTATCTCGAGATACGGTTTATGTGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-1358s1c1
Sequence:CCGGGCCTTGTTCAACATCAGAGTACTCGAGTACTCTGATGTTGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010880
ZNF780A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 780A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010880.2-830s21c1
Sequence:CCGGTTCGACTTCACATACAATTTACTCGAGTAAATTGTATGTGAAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010880.2-1596s21c1
Sequence:CCGGTTGCCAACTTATTGAACATTCCTCGAGGAATGTTCAATAAGTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-121s1c1
Sequence:CCGGCGGTATCCAGATTTGGAGTTACTCGAGTAACTCCAAATCTGGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-797s1c1
Sequence:CCGGCCAATGAGAAACCCTTTGTATCTCGAGATACAAAGGGTTTCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-595s1c1
Sequence:CCGGCTTACCCTGCTTAATCGCCATCTCGAGATGGCGATTAAGCAGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-373s1c1
Sequence:CCGGTGCAATACACATAAACCGTATCTCGAGATACGGTTTATGTGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-1358s1c1
Sequence:CCGGGCCTTGTTCAACATCAGAGTACTCGAGTACTCTGATGTTGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010880
ZNF780A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 780A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010880.2-830s21c1
Sequence:CCGGTTCGACTTCACATACAATTTACTCGAGTAAATTGTATGTGAAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010880.2-1596s21c1
Sequence:CCGGTTGCCAACTTATTGAACATTCCTCGAGGAATGTTCAATAAGTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-121s1c1
Sequence:CCGGCGGTATCCAGATTTGGAGTTACTCGAGTAACTCCAAATCTGGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-797s1c1
Sequence:CCGGCCAATGAGAAACCCTTTGTATCTCGAGATACAAAGGGTTTCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-595s1c1
Sequence:CCGGCTTACCCTGCTTAATCGCCATCTCGAGATGGCGATTAAGCAGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-373s1c1
Sequence:CCGGTGCAATACACATAAACCGTATCTCGAGATACGGTTTATGTGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010880.1-1358s1c1
Sequence:CCGGGCCTTGTTCAACATCAGAGTACTCGAGTACTCTGATGTTGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks