EMAIL THIS PAGE TO A FRIEND

ZNF780B

zinc finger protein 780B

Synonyms: ZNF779
Species: Human ZNF780B(163131), domestic cat ZNF780B(101089975), domestic guinea pig Znf780b(100716589)
UniProtKB ID: Q9Y6R6, B9EH00
Gene ID:
domestic cat(101089975) zinc finger protein 780B
domestic guinea pig(100716589) zinc finger protein 780B
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005851 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027986 predicted 955
2 SASI_Hs01_00027987 predicted 1938
3 SASI_Hs01_00027988 predicted 684
4 SASI_Hs01_00027989 predicted 458
5 SASI_Hs01_00027990 predicted 2027
6 SASI_Hs01_00027991 predicted 2135
7 SASI_Hs01_00027992 predicted 364
8 SASI_Hs01_00027993 predicted 458
9 SASI_Hs01_00027994 predicted 726
10 SASI_Hs01_00027995 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005851
ZNF780B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 780B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-434s1c1
Sequence:CCGGGCTATGAAGAAATGCCTGCTTCTCGAGAAGCAGGCATTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-448s1c1
Sequence:CCGGCCTGCTTATACTCATGCTTCTCTCGAGAGAAGCATGAGTATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-2206s1c1
Sequence:CCGGCTTCTGACACAGCTTGCTCAACTCGAGTTGAGCAAGCTGTGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-190s1c1
Sequence:CCGGCCCTGGATTGTTGTAAGTAAACTCGAGTTTACTTACAACAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-1739s1c1
Sequence:CCGGCCGGAAAGAAACCCTTTGAATCTCGAGATTCAAAGGGTTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005851
ZNF780B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 780B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-434s1c1
Sequence:CCGGGCTATGAAGAAATGCCTGCTTCTCGAGAAGCAGGCATTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-448s1c1
Sequence:CCGGCCTGCTTATACTCATGCTTCTCTCGAGAGAAGCATGAGTATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-2206s1c1
Sequence:CCGGCTTCTGACACAGCTTGCTCAACTCGAGTTGAGCAAGCTGTGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-190s1c1
Sequence:CCGGCCCTGGATTGTTGTAAGTAAACTCGAGTTTACTTACAACAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-1739s1c1
Sequence:CCGGCCGGAAAGAAACCCTTTGAATCTCGAGATTCAAAGGGTTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005851
ZNF780B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 780B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-434s1c1
Sequence:CCGGGCTATGAAGAAATGCCTGCTTCTCGAGAAGCAGGCATTTCTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-448s1c1
Sequence:CCGGCCTGCTTATACTCATGCTTCTCTCGAGAGAAGCATGAGTATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-2206s1c1
Sequence:CCGGCTTCTGACACAGCTTGCTCAACTCGAGTTGAGCAAGCTGTGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-190s1c1
Sequence:CCGGCCCTGGATTGTTGTAAGTAAACTCGAGTTTACTTACAACAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005851.1-1739s1c1
Sequence:CCGGCCGGAAAGAAACCCTTTGAATCTCGAGATTCAAAGGGTTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks