EMAIL THIS PAGE TO A FRIEND

ZNF781

zinc finger protein 781

Species: Human ZNF781(163115)
UniProtKB ID: Q8N8C0, Q2VPJ8
Gene ID:
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152605 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147881 MISSION® esiRNA esiRNA human ZNF781 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123812 predicted 894
2 SASI_Hs01_00123813 predicted 1638
3 SASI_Hs01_00123815 predicted 1091
4 SASI_Hs01_00123816 predicted 1638
5 SASI_Hs01_00123817 predicted 1052
6 SASI_Hs01_00123819 predicted 1522
7 SASI_Hs01_00123820 predicted 1104
8 SASI_Hs01_00123821 predicted 1651
9 SASI_Hs02_00366452 predicted 819
10 SASI_Hs02_00366453 predicted 966
11 SASI_Hs01_00123814 predicted 1385
12 SASI_Hs01_00123818 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152605
ZNF781 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 781
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-814s1c1
Sequence:CCGGGCCCACCTTACCCAACATAATCTCGAGATTATGTTGGGTAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1573s1c1
Sequence:CCGGCACTTGTTCAACATCAGAGAACTCGAGTTCTCTGATGTTGAACAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-760s1c1
Sequence:CCGGGCTAATCAGAAACCCTATGAACTCGAGTTCATAGGGTTTCTGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1638s1c1
Sequence:CCGGGCCTTCAAGCATAATGCACATCTCGAGATGTGCATTATGCTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1317s1c1
Sequence:CCGGGCACATCTTACTCAACATCAACTCGAGTTGATGTTGAGTAAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1205s21c1
Sequence:CCGGACAATCGCTCAACTCTTATTCCTCGAGGAATAAGAGTTGAGCGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1287s21c1
Sequence:CCGGCAATAATTGCTCAACACTTACCTCGAGGTAAGTGTTGAGCAATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-792s21c1
Sequence:CCGGACTTTCAACTAACTCAATATCCTCGAGGATATTGAGTTAGTTGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1446s21c1
Sequence:CCGGGAAGGCTTTCACTTGTGTTTCCTCGAGGAAACACAAGTGAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152605
ZNF781 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 781
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-814s1c1
Sequence:CCGGGCCCACCTTACCCAACATAATCTCGAGATTATGTTGGGTAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1573s1c1
Sequence:CCGGCACTTGTTCAACATCAGAGAACTCGAGTTCTCTGATGTTGAACAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-760s1c1
Sequence:CCGGGCTAATCAGAAACCCTATGAACTCGAGTTCATAGGGTTTCTGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1638s1c1
Sequence:CCGGGCCTTCAAGCATAATGCACATCTCGAGATGTGCATTATGCTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1317s1c1
Sequence:CCGGGCACATCTTACTCAACATCAACTCGAGTTGATGTTGAGTAAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1205s21c1
Sequence:CCGGACAATCGCTCAACTCTTATTCCTCGAGGAATAAGAGTTGAGCGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1287s21c1
Sequence:CCGGCAATAATTGCTCAACACTTACCTCGAGGTAAGTGTTGAGCAATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-792s21c1
Sequence:CCGGACTTTCAACTAACTCAATATCCTCGAGGATATTGAGTTAGTTGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1446s21c1
Sequence:CCGGGAAGGCTTTCACTTGTGTTTCCTCGAGGAAACACAAGTGAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152605
ZNF781 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 781
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-814s1c1
Sequence:CCGGGCCCACCTTACCCAACATAATCTCGAGATTATGTTGGGTAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1573s1c1
Sequence:CCGGCACTTGTTCAACATCAGAGAACTCGAGTTCTCTGATGTTGAACAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-760s1c1
Sequence:CCGGGCTAATCAGAAACCCTATGAACTCGAGTTCATAGGGTTTCTGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1638s1c1
Sequence:CCGGGCCTTCAAGCATAATGCACATCTCGAGATGTGCATTATGCTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152605.2-1317s1c1
Sequence:CCGGGCACATCTTACTCAACATCAACTCGAGTTGATGTTGAGTAAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1205s21c1
Sequence:CCGGACAATCGCTCAACTCTTATTCCTCGAGGAATAAGAGTTGAGCGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1287s21c1
Sequence:CCGGCAATAATTGCTCAACACTTACCTCGAGGTAAGTGTTGAGCAATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-792s21c1
Sequence:CCGGACTTTCAACTAACTCAATATCCTCGAGGATATTGAGTTAGTTGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152605.3-1446s21c1
Sequence:CCGGGAAGGCTTTCACTTGTGTTTCCTCGAGGAAACACAAGTGAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks