EMAIL THIS PAGE TO A FRIEND

ZNF782

zinc finger protein 782

UniProtKB ID: Q6ZMW2, B2RNR0
Gene ID:
domestic cat(101090653) zinc finger protein 782
dog(100687500) zinc finger protein 782
domestic guinea pig(100726379) zinc finger protein 782
naked mole-rat(101716119) zinc finger protein 782
cow(616883) zinc finger protein 782
sheep(101112888) zinc finger protein 782
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_098940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_098940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_098940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001662 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183000 predicted 1334
2 SASI_Hs01_00183001 predicted 662
3 SASI_Hs01_00183002 predicted 781
4 SASI_Hs01_00183003 predicted 964
5 SASI_Hs01_00183004 predicted 1060
6 SASI_Hs02_00303860 predicted 876
7 SASI_Hs01_00183005 predicted 1088
8 SASI_Hs01_00183006 predicted 1286
9 SASI_Hs01_00183007 predicted 1173
10 SASI_Hs02_00303861 predicted 440
11 SASI_Hs01_00183008 predicted 468
12 SASI_Hs01_00183009 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_098940
ZNF782 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 782
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_098940.6-2492s1c1
Sequence:CCGGGCTGGAAATCAAACCTCACAACTCGAGTTGTGAGGTTTGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1607s1c1
Sequence:CCGGCGGGAGAGAAACCATACAAATCTCGAGATTTGTATGGTTTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1806s1c1
Sequence:CCGGCGGGAAATCTTTCAGCCATATCTCGAGATATGGCTGAAAGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1805s1c1
Sequence:CCGGGCGGGAAATCTTTCAGCCATACTCGAGTATGGCTGAAAGATTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-945s1c1
Sequence:CCGGCCATCATAAGGAGGAAGTTATCTCGAGATAACTTCCTCCTTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_098940
ZNF782 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 782
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_098940.6-2492s1c1
Sequence:CCGGGCTGGAAATCAAACCTCACAACTCGAGTTGTGAGGTTTGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1607s1c1
Sequence:CCGGCGGGAGAGAAACCATACAAATCTCGAGATTTGTATGGTTTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1806s1c1
Sequence:CCGGCGGGAAATCTTTCAGCCATATCTCGAGATATGGCTGAAAGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1805s1c1
Sequence:CCGGGCGGGAAATCTTTCAGCCATACTCGAGTATGGCTGAAAGATTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-945s1c1
Sequence:CCGGCCATCATAAGGAGGAAGTTATCTCGAGATAACTTCCTCCTTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_098940
ZNF782 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 782
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_098940.6-2492s1c1
Sequence:CCGGGCTGGAAATCAAACCTCACAACTCGAGTTGTGAGGTTTGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1607s1c1
Sequence:CCGGCGGGAGAGAAACCATACAAATCTCGAGATTTGTATGGTTTCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1806s1c1
Sequence:CCGGCGGGAAATCTTTCAGCCATATCTCGAGATATGGCTGAAAGATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-1805s1c1
Sequence:CCGGGCGGGAAATCTTTCAGCCATACTCGAGTATGGCTGAAAGATTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098940.6-945s1c1
Sequence:CCGGCCATCATAAGGAGGAAGTTATCTCGAGATAACTTCCTCCTTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks