EMAIL THIS PAGE TO A FRIEND

ZNF784

zinc finger protein 784

UniProtKB ID: Q8NCA9
Gene ID:
domestic cat(101088534) zinc finger protein 784
dog(100688293) zinc finger protein 784
domestic guinea pig(100712875) zinc finger protein 784
naked mole-rat(101697831) zinc finger protein 784
cow(789593) zinc finger protein 784
sheep(101117959) zinc finger protein 784
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034600 predicted 1395
2 SASI_Hs01_00034603 predicted 1286
3 SASI_Hs01_00034601 predicted 1432
4 SASI_Hs01_00034602 predicted 1333
5 SASI_Hs01_00034604 predicted 123
6 SASI_Hs01_00034605 predicted 1106
7 SASI_Hs01_00034606 predicted 30
8 SASI_Hs01_00034607 predicted 1281
9 SASI_Hs01_00034608 predicted 498
10 SASI_Hs01_00034609 predicted 129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203374
ZNF784 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 784
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-791s1c1
Sequence:CCGGCACCTTCAACAACTCCTCCAACTCGAGTTGGAGGAGTTGTTGAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-236s1c1
Sequence:CCGGCCGGCTGGTTTCCGAGCTGCTCTCGAGAGCAGCTCGGAAACCAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-128s1c1
Sequence:CCGGCCCGAGTGACCTCATCGAGATCTCGAGATCTCGATGAGGTCACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-677s1c1
Sequence:CCGGGCGGCCATACCATTGCGGCATCTCGAGATGCCGCAATGGTATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-258s21c1
Sequence:CCGGTTCCACGAACATGGCCACTTGCTCGAGCAAGTGGCCATGTTCGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-91s21c1
Sequence:CCGGTGGTCCTGGTGCCTGATGACTCTCGAGAGTCATCAGGCACCAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-635s21c1
Sequence:CCGGCTCCTCAGACATGCGAGACCACTCGAGTGGTCTCGCATGTCTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203374.1-1116s21c1
Sequence:CCGGTGGTTGTGAGCCGCTAGTGATCTCGAGATCACTAGCGGCTCACAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203374
ZNF784 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 784
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-791s1c1
Sequence:CCGGCACCTTCAACAACTCCTCCAACTCGAGTTGGAGGAGTTGTTGAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-236s1c1
Sequence:CCGGCCGGCTGGTTTCCGAGCTGCTCTCGAGAGCAGCTCGGAAACCAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-128s1c1
Sequence:CCGGCCCGAGTGACCTCATCGAGATCTCGAGATCTCGATGAGGTCACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-677s1c1
Sequence:CCGGGCGGCCATACCATTGCGGCATCTCGAGATGCCGCAATGGTATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-258s21c1
Sequence:CCGGTTCCACGAACATGGCCACTTGCTCGAGCAAGTGGCCATGTTCGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-91s21c1
Sequence:CCGGTGGTCCTGGTGCCTGATGACTCTCGAGAGTCATCAGGCACCAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-635s21c1
Sequence:CCGGCTCCTCAGACATGCGAGACCACTCGAGTGGTCTCGCATGTCTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203374.1-1116s21c1
Sequence:CCGGTGGTTGTGAGCCGCTAGTGATCTCGAGATCACTAGCGGCTCACAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203374
ZNF784 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 784
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-791s1c1
Sequence:CCGGCACCTTCAACAACTCCTCCAACTCGAGTTGGAGGAGTTGTTGAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-236s1c1
Sequence:CCGGCCGGCTGGTTTCCGAGCTGCTCTCGAGAGCAGCTCGGAAACCAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-128s1c1
Sequence:CCGGCCCGAGTGACCTCATCGAGATCTCGAGATCTCGATGAGGTCACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203374.1-677s1c1
Sequence:CCGGGCGGCCATACCATTGCGGCATCTCGAGATGCCGCAATGGTATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-258s21c1
Sequence:CCGGTTCCACGAACATGGCCACTTGCTCGAGCAAGTGGCCATGTTCGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-91s21c1
Sequence:CCGGTGGTCCTGGTGCCTGATGACTCTCGAGAGTCATCAGGCACCAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203374.1-635s21c1
Sequence:CCGGCTCCTCAGACATGCGAGACCACTCGAGTGGTCTCGCATGTCTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203374.1-1116s21c1
Sequence:CCGGTGGTTGTGAGCCGCTAGTGATCTCGAGATCACTAGCGGCTCACAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks