EMAIL THIS PAGE TO A FRIEND

ZNF785

zinc finger protein 785

UniProtKB ID: A8K8V0, O75701, Q8IW91, Q8WV14, Q96MN0
Gene ID:
dog(607501) zinc finger protein 785
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152458 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160571 MISSION® esiRNA esiRNA human ZNF785 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152458 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013551 predicted 858
2 SASI_Hs01_00013552 predicted 1295
3 SASI_Hs01_00013553 predicted 715
4 SASI_Hs01_00013554 predicted 1367
5 SASI_Hs01_00013555 predicted 359
6 SASI_Hs01_00013556 predicted 1288
7 SASI_Hs01_00013557 predicted 1109
8 SASI_Hs01_00013558 predicted 1265
9 SASI_Hs01_00013559 predicted 1329
10 SASI_Hs01_00013560 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152458
ZNF785 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 785
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152458.5-288s21c1
Sequence:CCGGTTCAGTTCCCAAACCCGCTTTCTCGAGAAAGCGGGTTTGGGAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1394s21c1
Sequence:CCGGCAAAGTTCTGCCTTAGGTAAACTCGAGTTTACCTAAGGCAGAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1305s21c1
Sequence:CCGGACACAAACTGGTCAGCGTTTCCTCGAGGAAACGCTGACCAGTTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152458.5-1211s21c1
Sequence:CCGGGTTCAGAGCCCATCCCTGTTTCTCGAGAAACAGGGATGGGCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1742s21c1
Sequence:CCGGGAGCTCATCCCAGGATTCTTTCTCGAGAAAGAATCCTGGGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-1260s1c1
Sequence:CCGGCCGGCACTTTCCAGATATATTCTCGAGAATATATCTGGAAAGTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-611s1c1
Sequence:CCGGGCCGCAACTTCAGCTACCCTTCTCGAGAAGGGTAGCTGAAGTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-857s1c1
Sequence:CCGGACTGCAAGAGTCGCTTCACTTCTCGAGAAGTGAAGCGACTCTTGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-684s1c1
Sequence:CCGGCGGCCAGTGTCAGGCGCGTTTCTCGAGAAACGCGCCTGACACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-1249s1c1
Sequence:CCGGCCAGTTCACTTCCGGCACTTTCTCGAGAAAGTGCCGGAAGTGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152458
ZNF785 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 785
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152458.5-288s21c1
Sequence:CCGGTTCAGTTCCCAAACCCGCTTTCTCGAGAAAGCGGGTTTGGGAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1394s21c1
Sequence:CCGGCAAAGTTCTGCCTTAGGTAAACTCGAGTTTACCTAAGGCAGAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1305s21c1
Sequence:CCGGACACAAACTGGTCAGCGTTTCCTCGAGGAAACGCTGACCAGTTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152458.5-1211s21c1
Sequence:CCGGGTTCAGAGCCCATCCCTGTTTCTCGAGAAACAGGGATGGGCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1742s21c1
Sequence:CCGGGAGCTCATCCCAGGATTCTTTCTCGAGAAAGAATCCTGGGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-1260s1c1
Sequence:CCGGCCGGCACTTTCCAGATATATTCTCGAGAATATATCTGGAAAGTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-611s1c1
Sequence:CCGGGCCGCAACTTCAGCTACCCTTCTCGAGAAGGGTAGCTGAAGTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-857s1c1
Sequence:CCGGACTGCAAGAGTCGCTTCACTTCTCGAGAAGTGAAGCGACTCTTGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-684s1c1
Sequence:CCGGCGGCCAGTGTCAGGCGCGTTTCTCGAGAAACGCGCCTGACACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-1249s1c1
Sequence:CCGGCCAGTTCACTTCCGGCACTTTCTCGAGAAAGTGCCGGAAGTGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152458
ZNF785 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 785
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152458.5-288s21c1
Sequence:CCGGTTCAGTTCCCAAACCCGCTTTCTCGAGAAAGCGGGTTTGGGAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1394s21c1
Sequence:CCGGCAAAGTTCTGCCTTAGGTAAACTCGAGTTTACCTAAGGCAGAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1305s21c1
Sequence:CCGGACACAAACTGGTCAGCGTTTCCTCGAGGAAACGCTGACCAGTTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152458.5-1211s21c1
Sequence:CCGGGTTCAGAGCCCATCCCTGTTTCTCGAGAAACAGGGATGGGCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152458.5-1742s21c1
Sequence:CCGGGAGCTCATCCCAGGATTCTTTCTCGAGAAAGAATCCTGGGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-1260s1c1
Sequence:CCGGCCGGCACTTTCCAGATATATTCTCGAGAATATATCTGGAAAGTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-611s1c1
Sequence:CCGGGCCGCAACTTCAGCTACCCTTCTCGAGAAGGGTAGCTGAAGTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-857s1c1
Sequence:CCGGACTGCAAGAGTCGCTTCACTTCTCGAGAAGTGAAGCGACTCTTGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-684s1c1
Sequence:CCGGCGGCCAGTGTCAGGCGCGTTTCTCGAGAAACGCGCCTGACACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152458.4-1249s1c1
Sequence:CCGGCCAGTTCACTTCCGGCACTTTCTCGAGAAAGTGCCGGAAGTGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks