EMAIL THIS PAGE TO A FRIEND

ZNF786

zinc finger protein 786

UniProtKB ID: Q8N393, A1A568
Gene ID:
Horse(100060604) zinc finger protein 786
dog(100686024) zinc finger protein 786
domestic cat(101088827) zinc finger protein 786
cow(506408) zinc finger protein 786
sheep(101107089) zinc finger protein 786
naked mole-rat(101701324) zinc finger protein 786
domestic guinea pig(100717583) zinc finger protein 786
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152411 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118941 MISSION® esiRNA esiRNA human ZNF786 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366108 predicted 2412
2 SASI_Hs02_00366109 predicted 270
3 SASI_Hs02_00366110 predicted 732
4 SASI_Hs02_00366111 predicted 252
5 SASI_Hs02_00366112 predicted 2260
6 SASI_Hs01_00029986 predicted 489
7 SASI_Hs02_00366113 predicted 1569
8 SASI_Hs02_00366114 predicted 724
9 SASI_Hs02_00366115 predicted 2415
10 SASI_Hs02_00366116 predicted 951
11 SASI_Hs01_00029979 predicted 644
12 SASI_Hs01_00029980 predicted 1943
13 SASI_Hs01_00029981 predicted 549
14 SASI_Hs01_00029982 predicted 2248
15 SASI_Hs01_00029983 predicted 2364
16 SASI_Hs01_00029984 predicted 2022
17 SASI_Hs01_00029985 predicted 2017
18 SASI_Hs01_00029987 predicted 1256
19 SASI_Hs01_00029988 predicted 2339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152411
VALIDATED
ZNF786 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 786
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152411.1-2751s1c1
Sequence:CCGGCGAGGTTATATGTGATTGTTACTCGAGTAACAATCACATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-221s1c1
Sequence:CCGGGAACTAATATCCTGGATTGAACTCGAGTTCAATCCAGGATATTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-2335s1c1
Sequence:CCGGTCCAAATGAACTGGACATTAACTCGAGTTAATGTCCAGTTCATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-2271s1c1
Sequence:CCGGAGGGCTTCATTTACAAGTCTACTCGAGTAGACTTGTAAATGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-300s1c1
Sequence:CCGGGCTCCTCTGTTGATATGCATTCTCGAGAATGCATATCAACAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-1435s21c1
Sequence:CCGGGCTTCGCCAAGCAGTGTAAACCTCGAGGTTTACACTGCTTGGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-244s21c1
Sequence:CCGGATGTGATGAGAAGCAATTATGCTCGAGCATAATTGCTTCTCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_152411.3-723s21c1
Sequence:CCGGTGTTGGGAGAACAACCATTTACTCGAGTAAATGGTTGTTCTCCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152411.3-2738s21c1
Sequence:CCGGTGGCGTGATCCCAGCTATATTCTCGAGAATATAGCTGGGATCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-2449s21c1
Sequence:CCGGGCCAACTGTTTGCAATGATAGCTCGAGCTATCATTGCAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152411
VALIDATED
ZNF786 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 786
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152411.1-2751s1c1
Sequence:CCGGCGAGGTTATATGTGATTGTTACTCGAGTAACAATCACATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-221s1c1
Sequence:CCGGGAACTAATATCCTGGATTGAACTCGAGTTCAATCCAGGATATTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-2335s1c1
Sequence:CCGGTCCAAATGAACTGGACATTAACTCGAGTTAATGTCCAGTTCATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-2271s1c1
Sequence:CCGGAGGGCTTCATTTACAAGTCTACTCGAGTAGACTTGTAAATGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-300s1c1
Sequence:CCGGGCTCCTCTGTTGATATGCATTCTCGAGAATGCATATCAACAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-1435s21c1
Sequence:CCGGGCTTCGCCAAGCAGTGTAAACCTCGAGGTTTACACTGCTTGGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-244s21c1
Sequence:CCGGATGTGATGAGAAGCAATTATGCTCGAGCATAATTGCTTCTCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_152411.3-723s21c1
Sequence:CCGGTGTTGGGAGAACAACCATTTACTCGAGTAAATGGTTGTTCTCCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152411.3-2738s21c1
Sequence:CCGGTGGCGTGATCCCAGCTATATTCTCGAGAATATAGCTGGGATCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-2449s21c1
Sequence:CCGGGCCAACTGTTTGCAATGATAGCTCGAGCTATCATTGCAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152411
VALIDATED
ZNF786 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 786
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152411.1-2751s1c1
Sequence:CCGGCGAGGTTATATGTGATTGTTACTCGAGTAACAATCACATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-221s1c1
Sequence:CCGGGAACTAATATCCTGGATTGAACTCGAGTTCAATCCAGGATATTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-2335s1c1
Sequence:CCGGTCCAAATGAACTGGACATTAACTCGAGTTAATGTCCAGTTCATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-2271s1c1
Sequence:CCGGAGGGCTTCATTTACAAGTCTACTCGAGTAGACTTGTAAATGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152411.1-300s1c1
Sequence:CCGGGCTCCTCTGTTGATATGCATTCTCGAGAATGCATATCAACAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-1435s21c1
Sequence:CCGGGCTTCGCCAAGCAGTGTAAACCTCGAGGTTTACACTGCTTGGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-244s21c1
Sequence:CCGGATGTGATGAGAAGCAATTATGCTCGAGCATAATTGCTTCTCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_152411.3-723s21c1
Sequence:CCGGTGTTGGGAGAACAACCATTTACTCGAGTAAATGGTTGTTCTCCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152411.3-2738s21c1
Sequence:CCGGTGGCGTGATCCCAGCTATATTCTCGAGAATATAGCTGGGATCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152411.3-2449s21c1
Sequence:CCGGGCCAACTGTTTGCAATGATAGCTCGAGCTATCATTGCAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks