EMAIL THIS PAGE TO A FRIEND

ZNF787

zinc finger protein 787

Synonyms: TIP20
UniProtKB ID: Q6DD87, O00455
Gene ID:
domestic guinea pig(100714253) zinc finger protein 787
naked mole-rat(101718428) zinc finger protein 787
cow(613703) zinc finger protein 787
sheep(101109641) zinc finger protein 787
domestic cat(101080926) zinc finger protein 787
dog(484286) zinc finger protein 787
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102963 Anti-ZNF787 antibody produced in rabbit affinity isolated antibody bovine, rat, human, mouse, guinea pig
western blot pricing
HPA035140 Anti-ZNF787 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_058999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_058999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_058999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002836 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109472 predicted 411
2 SASI_Hs01_00109473 predicted 193
3 SASI_Hs01_00109474 predicted 1436
4 SASI_Hs01_00109475 predicted 953
5 SASI_Hs01_00109476 predicted 167
6 SASI_Hs01_00109477 predicted 681
7 SASI_Hs01_00109478 predicted 351
8 SASI_Hs01_00109479 predicted 1434
9 SASI_Hs01_00109480 predicted 333
10 SASI_Hs01_00109481 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_058999
ZNF787 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 787
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-411s1c1
Sequence:CCGGGCGCATCCACACGGGCGAGAACTCGAGTTCTCGCCCGTGTGGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_058999.9-1477s1c1
Sequence:CCGGCCGGAGAGACAATGGAGAGAACTCGAGTTCTCTCCATTGTCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-154s1c1
Sequence:CCGGGACATCCTCATCATGGATGATCTCGAGATCATCCATGATGAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-151s1c1
Sequence:CCGGGTGGACATCCTCATCATGGATCTCGAGATCCATGATGAGGATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-540s1c1
Sequence:CCGGCCGCAGCTTCACTCAGAGCAACTCGAGTTGCTCTGAGTGAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_058999
ZNF787 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 787
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-411s1c1
Sequence:CCGGGCGCATCCACACGGGCGAGAACTCGAGTTCTCGCCCGTGTGGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_058999.9-1477s1c1
Sequence:CCGGCCGGAGAGACAATGGAGAGAACTCGAGTTCTCTCCATTGTCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-154s1c1
Sequence:CCGGGACATCCTCATCATGGATGATCTCGAGATCATCCATGATGAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-151s1c1
Sequence:CCGGGTGGACATCCTCATCATGGATCTCGAGATCCATGATGAGGATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-540s1c1
Sequence:CCGGCCGCAGCTTCACTCAGAGCAACTCGAGTTGCTCTGAGTGAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_058999
ZNF787 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 787
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-411s1c1
Sequence:CCGGGCGCATCCACACGGGCGAGAACTCGAGTTCTCGCCCGTGTGGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_058999.9-1477s1c1
Sequence:CCGGCCGGAGAGACAATGGAGAGAACTCGAGTTCTCTCCATTGTCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-154s1c1
Sequence:CCGGGACATCCTCATCATGGATGATCTCGAGATCATCCATGATGAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-151s1c1
Sequence:CCGGGTGGACATCCTCATCATGGATCTCGAGATCCATGATGAGGATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_058999.9-540s1c1
Sequence:CCGGCCGCAGCTTCACTCAGAGCAACTCGAGTTGCTCTGAGTGAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks