EMAIL THIS PAGE TO A FRIEND

ZNF788

zinc finger family member 788

Species: Human ZNF788(388507)
UniProtKB ID: Q6ZQV5, Q6ZRE4
Gene ID:
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004314 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_930581 Rosetta Predictions human pricing
XR_015208 Rosetta Predictions human pricing
XR_015647 Rosetta Predictions human pricing
XR_041527 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252331 predicted 1002
2 SASI_Hs01_00252332 predicted 2248
3 SASI_Hs01_00252333 predicted 1421
4 SASI_Hs01_00252334 predicted 1406
5 SASI_Hs01_00252335 predicted 2291
6 SASI_Hs01_00252336 predicted 2543
7 SASI_Hs01_00252337 predicted 2251
8 SASI_Hs01_00252338 predicted 2326
9 SASI_Hs01_00252339 predicted 893
10 SASI_Hs01_00252340 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00487459 predicted 1173
2 SASI_Hs02_00487460 predicted 2412
3 SASI_Hs02_00487461 predicted 1583
4 SASI_Hs02_00487462 predicted 1576
5 SASI_Hs02_00487463 predicted 2457
6 SASI_Hs02_00487464 predicted 655
7 SASI_Hs02_00487465 predicted 2411
8 SASI_Hs02_00487466 predicted 2495
9 SASI_Hs02_00487467 predicted 2451
10 SASI_Hs02_00487468 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488741 predicted 1171
2 SASI_Hs02_00488742 predicted 2410
3 SASI_Hs02_00488743 predicted 1586
4 SASI_Hs02_00488744 predicted 1575
5 SASI_Hs02_00488745 predicted 2459
6 SASI_Hs02_00488746 predicted 650
7 SASI_Hs02_00488747 predicted 2410
8 SASI_Hs02_00488748 predicted 2494
9 SASI_Hs02_00488749 predicted 2452
10 SASI_Hs02_00488750 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528088 predicted 1165
2 SASI_Hs02_00528089 predicted 2404
3 SASI_Hs02_00528090 predicted 1586
4 SASI_Hs02_00528091 predicted 1573
5 SASI_Hs02_00528092 predicted 2460
6 SASI_Hs02_00528093 predicted 653
7 SASI_Hs02_00528094 predicted 2416
8 SASI_Hs02_00528095 predicted 2494
9 SASI_Hs02_00528096 predicted 2459
10 SASI_Hs02_00528097 predicted 1853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004314
ZNF788 MISSION shRNA Bacterial Glycerol Stock
zinc finger family member 788
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004314.2-2712s1c1
Sequence:CCGGCCGGAGAGAAACCATGTGAATCTCGAGATTCACATGGTTTCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-924s1c1
Sequence:CCGGCTGGTTTCTATCATAGACATACTCGAGTATGTCTATGATAGAAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-1350s1c1
Sequence:CCGGGCCTTCAGGTACATGAAGTAACTCGAGTTACTTCATGTACCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-2184s1c1
Sequence:CCGGGCCTTCGAATACATGGACTAACTCGAGTTAGTCCATGTATTCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-2097s1c1
Sequence:CCGGCACACCTACGAACACATGAAACTCGAGTTTCATGTGTTCGTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004314
ZNF788 MISSION shRNA shRNA Plasmid DNA
zinc finger family member 788
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004314.2-2712s1c1
Sequence:CCGGCCGGAGAGAAACCATGTGAATCTCGAGATTCACATGGTTTCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-924s1c1
Sequence:CCGGCTGGTTTCTATCATAGACATACTCGAGTATGTCTATGATAGAAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-1350s1c1
Sequence:CCGGGCCTTCAGGTACATGAAGTAACTCGAGTTACTTCATGTACCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-2184s1c1
Sequence:CCGGGCCTTCGAATACATGGACTAACTCGAGTTAGTCCATGTATTCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-2097s1c1
Sequence:CCGGCACACCTACGAACACATGAAACTCGAGTTTCATGTGTTCGTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004314
ZNF788 MISSION shRNA Lentiviral Transduction Particles
zinc finger family member 788
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004314.2-2712s1c1
Sequence:CCGGCCGGAGAGAAACCATGTGAATCTCGAGATTCACATGGTTTCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-924s1c1
Sequence:CCGGCTGGTTTCTATCATAGACATACTCGAGTATGTCTATGATAGAAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-1350s1c1
Sequence:CCGGGCCTTCAGGTACATGAAGTAACTCGAGTTACTTCATGTACCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-2184s1c1
Sequence:CCGGGCCTTCGAATACATGGACTAACTCGAGTTAGTCCATGTATTCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004314.2-2097s1c1
Sequence:CCGGCACACCTACGAACACATGAAACTCGAGTTTCATGTGTTCGTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks