EMAIL THIS PAGE TO A FRIEND

ZNF789

zinc finger protein 789

UniProtKB ID: Q5FWF6, A4D282, A6NH61, Q6ZMZ9
Gene ID:
domestic cat(101096192) zinc finger protein 789
cow(789074) zinc finger protein 789
sheep(101111930) zinc finger protein 789
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376657 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013258 Rosetta Predictions human pricing
NM_213603 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069452 predicted 241
2 SASI_Hs01_00069453 predicted 247
3 SASI_Hs01_00069454 predicted 253
4 SASI_Hs01_00069455 predicted 262
5 SASI_Hs01_00069456 predicted 264
6 SASI_Hs01_00069458 predicted 247
7 SASI_Hs01_00069459 predicted 261
8 SASI_Hs01_00069460 predicted 256
9 SASI_Hs01_00069461 predicted 248
10 SASI_Hs01_00069457 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015757 predicted 981
2 SASI_Hs01_00015758 predicted 530
3 SASI_Hs01_00015759 predicted 1146
4 SASI_Hs01_00015760 predicted 430
5 SASI_Hs01_00015761 predicted 531
6 SASI_Hs02_00374282 predicted 1216
7 SASI_Hs01_00015762 predicted 647
8 SASI_Hs01_00015763 predicted 757
9 SASI_Hs01_00015764 predicted 992
10 SASI_Hs01_00015766 predicted 755
11 SASI_Hs01_00015765 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376657
ZNF789 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 789
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-1240s1c1
Sequence:CCGGCGGCATTCAACCCTTCTATGTCTCGAGACATAGAAGGGTTGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-789s1c1
Sequence:CCGGCAGATATGATGAGGATGGCAACTCGAGTTGCCATCCTCATCATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-686s1c1
Sequence:CCGGGCAGGCTTACTTTCCCTACTACTCGAGTAGTAGGGAAAGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-1344s1c1
Sequence:CCGGGCATCAAAGAATCCATACAAACTCGAGTTTGTATGGATTCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-994s1c1
Sequence:CCGGTCAGCTCTTACGGTCCATAAACTCGAGTTTATGGACCGTAAGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376657
ZNF789 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 789
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-1240s1c1
Sequence:CCGGCGGCATTCAACCCTTCTATGTCTCGAGACATAGAAGGGTTGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-789s1c1
Sequence:CCGGCAGATATGATGAGGATGGCAACTCGAGTTGCCATCCTCATCATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-686s1c1
Sequence:CCGGGCAGGCTTACTTTCCCTACTACTCGAGTAGTAGGGAAAGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-1344s1c1
Sequence:CCGGGCATCAAAGAATCCATACAAACTCGAGTTTGTATGGATTCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-994s1c1
Sequence:CCGGTCAGCTCTTACGGTCCATAAACTCGAGTTTATGGACCGTAAGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376657
ZNF789 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 789
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-1240s1c1
Sequence:CCGGCGGCATTCAACCCTTCTATGTCTCGAGACATAGAAGGGTTGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-789s1c1
Sequence:CCGGCAGATATGATGAGGATGGCAACTCGAGTTGCCATCCTCATCATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-686s1c1
Sequence:CCGGGCAGGCTTACTTTCCCTACTACTCGAGTAGTAGGGAAAGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-1344s1c1
Sequence:CCGGGCATCAAAGAATCCATACAAACTCGAGTTTGTATGGATTCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376657.1-994s1c1
Sequence:CCGGTCAGCTCTTACGGTCCATAAACTCGAGTTTATGGACCGTAAGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks