EMAIL THIS PAGE TO A FRIEND

ZNF790

zinc finger protein 790

UniProtKB ID: Q6PG37
Gene ID:
Horse(100062078) zinc finger protein 790
dog(484548) zinc finger protein 790
domestic cat(101081099) zinc finger protein 790
cow(519309) zinc finger protein 790
sheep(101108680) zinc finger protein 790
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021941 MISSION® esiRNA esiRNA human ZNF790 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206894 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097319 predicted 409
2 SASI_Hs01_00097320 predicted 1615
3 SASI_Hs01_00097321 predicted 1748
4 SASI_Hs02_00373587 predicted 1787
5 SASI_Hs01_00097322 predicted 919
6 SASI_Hs01_00097323 predicted 1907
7 SASI_Hs01_00097324 predicted 410
8 SASI_Hs01_00097325 predicted 1279
9 SASI_Hs01_00097326 predicted 714
10 SASI_Hs01_00097327 predicted 1887
11 SASI_Hs01_00097318 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206894
ZNF790 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 790
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-592s21c1
Sequence:CCGGATCTACACCAGAGACTTAATACTCGAGTATTAAGTCTCTGGTGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-187s21c1
Sequence:CCGGACCTGGAACAGAGGGATTTATCTCGAGATAAATCCCTCTGTTCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-1283s21c1
Sequence:CCGGTGTTGGTAGGAAACCTTATAACTCGAGTTATAAGGTTTCCTACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206894.1-2181s1c1
Sequence:CCGGGCAGAGAATTCATCATGCAATCTCGAGATTGCATGATGAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-1826s1c1
Sequence:CCGGGCCACATCTTTAGTCACCATTCTCGAGAATGGTGACTAAAGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-1423s1c1
Sequence:CCGGGCTTCGTATCTTGCTCAACATCTCGAGATGTTGAGCAAGATACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-655s1c1
Sequence:CCGGGCCTTTATTTCTGGTTCAGATCTCGAGATCTGAACCAGAAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-280s1c1
Sequence:CCGGGCGTTCTCTTTATTGGAGAAACTCGAGTTTCTCCAATAAAGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206894
ZNF790 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 790
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-592s21c1
Sequence:CCGGATCTACACCAGAGACTTAATACTCGAGTATTAAGTCTCTGGTGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-187s21c1
Sequence:CCGGACCTGGAACAGAGGGATTTATCTCGAGATAAATCCCTCTGTTCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-1283s21c1
Sequence:CCGGTGTTGGTAGGAAACCTTATAACTCGAGTTATAAGGTTTCCTACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206894.1-2181s1c1
Sequence:CCGGGCAGAGAATTCATCATGCAATCTCGAGATTGCATGATGAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-1826s1c1
Sequence:CCGGGCCACATCTTTAGTCACCATTCTCGAGAATGGTGACTAAAGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-1423s1c1
Sequence:CCGGGCTTCGTATCTTGCTCAACATCTCGAGATGTTGAGCAAGATACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-655s1c1
Sequence:CCGGGCCTTTATTTCTGGTTCAGATCTCGAGATCTGAACCAGAAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-280s1c1
Sequence:CCGGGCGTTCTCTTTATTGGAGAAACTCGAGTTTCTCCAATAAAGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206894
ZNF790 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 790
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-592s21c1
Sequence:CCGGATCTACACCAGAGACTTAATACTCGAGTATTAAGTCTCTGGTGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-187s21c1
Sequence:CCGGACCTGGAACAGAGGGATTTATCTCGAGATAAATCCCTCTGTTCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206894.2-1283s21c1
Sequence:CCGGTGTTGGTAGGAAACCTTATAACTCGAGTTATAAGGTTTCCTACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206894.1-2181s1c1
Sequence:CCGGGCAGAGAATTCATCATGCAATCTCGAGATTGCATGATGAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-1826s1c1
Sequence:CCGGGCCACATCTTTAGTCACCATTCTCGAGAATGGTGACTAAAGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-1423s1c1
Sequence:CCGGGCTTCGTATCTTGCTCAACATCTCGAGATGTTGAGCAAGATACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-655s1c1
Sequence:CCGGGCCTTTATTTCTGGTTCAGATCTCGAGATCTGAACCAGAAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206894.1-280s1c1
Sequence:CCGGGCGTTCTCTTTATTGGAGAAACTCGAGTTTCTCCAATAAAGAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks