EMAIL THIS PAGE TO A FRIEND

ZNF791

zinc finger protein 791

UniProtKB ID: Q3KP31, Q8NC99
Gene ID:
dog(484933) zinc finger protein 791
cow(783540) zinc finger protein 791
naked mole-rat(101716987) zinc finger protein 791
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153358 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119501 MISSION® esiRNA esiRNA human ZNF791 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153358 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062596 predicted 553
2 SASI_Hs01_00062597 predicted 726
3 SASI_Hs01_00062598 predicted 1167
4 SASI_Hs01_00062599 predicted 517
5 SASI_Hs02_00367223 predicted 517
6 SASI_Hs01_00062600 predicted 1758
7 SASI_Hs01_00062601 predicted 1570
8 SASI_Hs01_00062602 predicted 505
9 SASI_Hs01_00062603 predicted 1499
10 SASI_Hs01_00062604 predicted 1734
11 SASI_Hs01_00062595 predicted 1784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153358
ZNF791 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 791
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153358.1-1949s1c1
Sequence:CCGGGAAGAGAGAAATCCTGTCAATCTCGAGATTGACAGGATTTCTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-516s1c1
Sequence:CCGGCGAGCTATTTGAGAAGCCATACTCGAGTATGGCTTCTCAAATAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-1754s1c1
Sequence:CCGGCCTTTCAAAGACATACAAGAACTCGAGTTCTTGTATGTCTTTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-320s1c1
Sequence:CCGGGACGAAATCTAAGAAGCCATACTCGAGTATGGCTTCTTAGATTTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-1580s1c1
Sequence:CCGGCTAGTTACATTCGGATACATACTCGAGTATGTATCCGAATGTAACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2115s21c1
Sequence:CCGGATTTCTATCAACCGCAATTTACTCGAGTAAATTGCGGTTGATAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153358.2-960s21c1
Sequence:CCGGCAACGGAGATAGACCTTATAACTCGAGTTATAAGGTCTATCTCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2150s21c1
Sequence:CCGGACCATAGTGCAGCACATTATTCTCGAGAATAATGTGCTGCACTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153358.2-435s21c1
Sequence:CCGGGAAGAAGACTGCCGGAGTAAACTCGAGTTTACTCCGGCAGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2058s21c1
Sequence:CCGGAGTCAGCAATGGACCATATAGCTCGAGCTATATGGTCCATTGCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153358
ZNF791 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 791
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153358.1-1949s1c1
Sequence:CCGGGAAGAGAGAAATCCTGTCAATCTCGAGATTGACAGGATTTCTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-516s1c1
Sequence:CCGGCGAGCTATTTGAGAAGCCATACTCGAGTATGGCTTCTCAAATAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-1754s1c1
Sequence:CCGGCCTTTCAAAGACATACAAGAACTCGAGTTCTTGTATGTCTTTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-320s1c1
Sequence:CCGGGACGAAATCTAAGAAGCCATACTCGAGTATGGCTTCTTAGATTTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-1580s1c1
Sequence:CCGGCTAGTTACATTCGGATACATACTCGAGTATGTATCCGAATGTAACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2115s21c1
Sequence:CCGGATTTCTATCAACCGCAATTTACTCGAGTAAATTGCGGTTGATAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153358.2-960s21c1
Sequence:CCGGCAACGGAGATAGACCTTATAACTCGAGTTATAAGGTCTATCTCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2150s21c1
Sequence:CCGGACCATAGTGCAGCACATTATTCTCGAGAATAATGTGCTGCACTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153358.2-435s21c1
Sequence:CCGGGAAGAAGACTGCCGGAGTAAACTCGAGTTTACTCCGGCAGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2058s21c1
Sequence:CCGGAGTCAGCAATGGACCATATAGCTCGAGCTATATGGTCCATTGCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153358
ZNF791 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 791
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153358.1-1949s1c1
Sequence:CCGGGAAGAGAGAAATCCTGTCAATCTCGAGATTGACAGGATTTCTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-516s1c1
Sequence:CCGGCGAGCTATTTGAGAAGCCATACTCGAGTATGGCTTCTCAAATAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-1754s1c1
Sequence:CCGGCCTTTCAAAGACATACAAGAACTCGAGTTCTTGTATGTCTTTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-320s1c1
Sequence:CCGGGACGAAATCTAAGAAGCCATACTCGAGTATGGCTTCTTAGATTTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153358.1-1580s1c1
Sequence:CCGGCTAGTTACATTCGGATACATACTCGAGTATGTATCCGAATGTAACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2115s21c1
Sequence:CCGGATTTCTATCAACCGCAATTTACTCGAGTAAATTGCGGTTGATAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153358.2-960s21c1
Sequence:CCGGCAACGGAGATAGACCTTATAACTCGAGTTATAAGGTCTATCTCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2150s21c1
Sequence:CCGGACCATAGTGCAGCACATTATTCTCGAGAATAATGTGCTGCACTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153358.2-435s21c1
Sequence:CCGGGAAGAAGACTGCCGGAGTAAACTCGAGTTTACTCCGGCAGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153358.2-2058s21c1
Sequence:CCGGAGTCAGCAATGGACCATATAGCTCGAGCTATATGGTCCATTGCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks