EMAIL THIS PAGE TO A FRIEND

ZNF792

zinc finger protein 792

UniProtKB ID: Q3KQV3, B4E333, Q495L1, Q495L3, Q8N932
Gene ID:
naked mole-rat(101714791) zinc finger protein 792
domestic guinea pig(101789276) zinc finger protein 792
cow(519314) zinc finger protein 792
sheep(101122622) zinc finger protein 792
Horse(100050340) zinc finger protein 792
domestic cat(101080850) zinc finger protein 792
dog(484586) zinc finger protein 792
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175872 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005161 MISSION® esiRNA esiRNA targeting human ZNF792 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175872 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116855 predicted 1284
2 SASI_Hs01_00116856 predicted 2189
3 SASI_Hs01_00116857 predicted 1860
4 SASI_Hs02_00369147 predicted 1140
5 SASI_Hs02_00369148 predicted 1140
6 SASI_Hs01_00116859 predicted 2213
7 SASI_Hs01_00116861 predicted 1938
8 SASI_Hs01_00116862 predicted 2211
9 SASI_Hs01_00116863 predicted 2322
10 SASI_Hs02_00369149 predicted 543
11 SASI_Hs01_00116858 predicted 1619
12 SASI_Hs01_00116860 predicted 1444
13 SASI_Hs01_00116864 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175872
ZNF792 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 792
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1166s21c1
Sequence:CCGGGGGATGCCTTCAATAACAAATCTCGAGATTTGTTATTGAAGGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175872.4-2934s21c1
Sequence:CCGGGTAGGAATTTATGGGTATAATCTCGAGATTATACCCATAAATTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-536s21c1
Sequence:CCGGTAGCCTCGCTGGGACTTATATCTCGAGATATAAGTCCCAGCGAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1599s21c1
Sequence:CCGGCTGCAACTCCAGCCTAATTAACTCGAGTTAATTAGGCTGGAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1107s21c1
Sequence:CCGGCACCGAAGGTGTGGTGGATTTCTCGAGAAATCCACCACACCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-915s1c1
Sequence:CCGGCGTTCCAACCTCATTCATCATCTCGAGATGATGAATGAGGTTGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-326s1c1
Sequence:CCGGGCAGAACGTACACAACCCTATCTCGAGATAGGGTTGTGTACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-225s1c1
Sequence:CCGGGCTGAACACCAGACAACACATCTCGAGATGTGTTGTCTGGTGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175872
ZNF792 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 792
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1166s21c1
Sequence:CCGGGGGATGCCTTCAATAACAAATCTCGAGATTTGTTATTGAAGGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175872.4-2934s21c1
Sequence:CCGGGTAGGAATTTATGGGTATAATCTCGAGATTATACCCATAAATTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-536s21c1
Sequence:CCGGTAGCCTCGCTGGGACTTATATCTCGAGATATAAGTCCCAGCGAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1599s21c1
Sequence:CCGGCTGCAACTCCAGCCTAATTAACTCGAGTTAATTAGGCTGGAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1107s21c1
Sequence:CCGGCACCGAAGGTGTGGTGGATTTCTCGAGAAATCCACCACACCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-915s1c1
Sequence:CCGGCGTTCCAACCTCATTCATCATCTCGAGATGATGAATGAGGTTGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-326s1c1
Sequence:CCGGGCAGAACGTACACAACCCTATCTCGAGATAGGGTTGTGTACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-225s1c1
Sequence:CCGGGCTGAACACCAGACAACACATCTCGAGATGTGTTGTCTGGTGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175872
ZNF792 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 792
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1166s21c1
Sequence:CCGGGGGATGCCTTCAATAACAAATCTCGAGATTTGTTATTGAAGGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175872.4-2934s21c1
Sequence:CCGGGTAGGAATTTATGGGTATAATCTCGAGATTATACCCATAAATTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-536s21c1
Sequence:CCGGTAGCCTCGCTGGGACTTATATCTCGAGATATAAGTCCCAGCGAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1599s21c1
Sequence:CCGGCTGCAACTCCAGCCTAATTAACTCGAGTTAATTAGGCTGGAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175872.4-1107s21c1
Sequence:CCGGCACCGAAGGTGTGGTGGATTTCTCGAGAAATCCACCACACCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-915s1c1
Sequence:CCGGCGTTCCAACCTCATTCATCATCTCGAGATGATGAATGAGGTTGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-326s1c1
Sequence:CCGGGCAGAACGTACACAACCCTATCTCGAGATAGGGTTGTGTACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175872.3-225s1c1
Sequence:CCGGGCTGAACACCAGACAACACATCTCGAGATGTGTTGTCTGGTGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks