EMAIL THIS PAGE TO A FRIEND

ZNF793

zinc finger protein 793

UniProtKB ID: Q6ZN11, E9PGN4, Q7Z3Q9
Gene ID:
Horse(100061870) zinc finger protein 793
cow(101907389) zinc finger protein 793
sheep(101107625) zinc finger protein 793
domestic guinea pig(100718761) zinc finger protein 793
naked mole-rat(101716200) zinc finger protein 793
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026524 predicted 944
2 SASI_Hs01_00026525 predicted 961
3 SASI_Hs01_00026527 predicted 1013
4 SASI_Hs01_00026528 predicted 931
5 SASI_Hs01_00026529 predicted 846
6 SASI_Hs01_00026530 predicted 1060
7 SASI_Hs01_00026531 predicted 925
8 SASI_Hs02_00306430 predicted 861
9 SASI_Hs01_00026532 predicted 682
10 SASI_Hs02_00306431 predicted 1072
11 SASI_Hs01_00026526 predicted 813
12 SASI_Hs01_00026533 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013659
ZNF793 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 793
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-691s1c1
Sequence:CCGGGCGAGTTAATATCCAGAGGAACTCGAGTTCCTCTGGATATTAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-846s1c1
Sequence:CCGGGCCCTAGTAACTGGAACCCTTCTCGAGAAGGGTTCCAGTTACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013659.1-1736s1c1
Sequence:CCGGGCCATTAAGGTGGACAAATTACTCGAGTAATTTGTCCACCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-862s1c1
Sequence:CCGGCCCTTGTGGAAAGAATTTGAACTCGAGTTCAAATTCTTTCCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-1489s1c1
Sequence:CCGGCCAGAAGTCATGCCTCAATAACTCGAGTTATTGAGGCATGACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013659
ZNF793 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 793
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-691s1c1
Sequence:CCGGGCGAGTTAATATCCAGAGGAACTCGAGTTCCTCTGGATATTAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-846s1c1
Sequence:CCGGGCCCTAGTAACTGGAACCCTTCTCGAGAAGGGTTCCAGTTACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013659.1-1736s1c1
Sequence:CCGGGCCATTAAGGTGGACAAATTACTCGAGTAATTTGTCCACCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-862s1c1
Sequence:CCGGCCCTTGTGGAAAGAATTTGAACTCGAGTTCAAATTCTTTCCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-1489s1c1
Sequence:CCGGCCAGAAGTCATGCCTCAATAACTCGAGTTATTGAGGCATGACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013659
ZNF793 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 793
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-691s1c1
Sequence:CCGGGCGAGTTAATATCCAGAGGAACTCGAGTTCCTCTGGATATTAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-846s1c1
Sequence:CCGGGCCCTAGTAACTGGAACCCTTCTCGAGAAGGGTTCCAGTTACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013659.1-1736s1c1
Sequence:CCGGGCCATTAAGGTGGACAAATTACTCGAGTAATTTGTCCACCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-862s1c1
Sequence:CCGGCCCTTGTGGAAAGAATTTGAACTCGAGTTCAAATTCTTTCCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013659.1-1489s1c1
Sequence:CCGGCCAGAAGTCATGCCTCAATAACTCGAGTTATTGAGGCATGACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks