EMAIL THIS PAGE TO A FRIEND

ZNF799

zinc finger protein 799

Synonyms: HIT-40 ZNF842
Species: Human ZNF799(90576)
UniProtKB ID: Q96GE5
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080821 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080821 Rosetta Predictions human pricing
XM_930351 Rosetta Predictions human pricing
XM_934689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316010 predicted 458
2 SASI_Hs02_00316011 predicted 1123
3 SASI_Hs02_00316012 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277106 predicted 2005
2 SASI_Hs01_00277107 predicted 2674
3 SASI_Hs01_00277108 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266094 predicted 961
2 SASI_Hs01_00266095 predicted 1632
3 SASI_Hs01_00266096 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080821
ZNF799 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 799
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000444979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-723s21c1
Sequence:CCGGGCGTGGAGATGGACCTTATAACTCGAGTTATAAGGTCCATCTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-1143s21c1
Sequence:CCGGCACGAGAGATGGACCTCATAACTCGAGTTATGAGGTCCATCTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-1614s21c1
Sequence:CCGGCCAATACCTTTCTCAACATAGCTCGAGCTATGTTGAGAAAGGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080821
ZNF799 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 799
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000444979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-723s21c1
Sequence:CCGGGCGTGGAGATGGACCTTATAACTCGAGTTATAAGGTCCATCTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-1143s21c1
Sequence:CCGGCACGAGAGATGGACCTCATAACTCGAGTTATGAGGTCCATCTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-1614s21c1
Sequence:CCGGCCAATACCTTTCTCAACATAGCTCGAGCTATGTTGAGAAAGGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080821
ZNF799 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 799
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000444979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-723s21c1
Sequence:CCGGGCGTGGAGATGGACCTTATAACTCGAGTTATAAGGTCCATCTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-1143s21c1
Sequence:CCGGCACGAGAGATGGACCTCATAACTCGAGTTATGAGGTCCATCTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080821.1-1614s21c1
Sequence:CCGGCCAATACCTTTCTCAACATAGCTCGAGCTATGTTGAGAAAGGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks