EMAIL THIS PAGE TO A FRIEND

ZNF79

zinc finger protein 79

Synonyms: pT7
UniProtKB ID: Q15937, Q5VVW1, Q96NV1
Gene ID:
cow(614564) zinc finger protein 79
sheep(101103706) zinc finger protein 79
dog(100685774) zinc finger protein 79
domestic cat(101091316) zinc finger protein 79
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007135 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035011 MISSION® esiRNA esiRNA human ZNF79 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007135 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226440 predicted 1527
2 SASI_Hs01_00226441 predicted 860
3 SASI_Hs01_00226443 predicted 1354
4 SASI_Hs01_00226444 predicted 1757
5 SASI_Hs01_00226445 predicted 952
6 SASI_Hs01_00226446 predicted 958
7 SASI_Hs01_00226447 predicted 1536
8 SASI_Hs01_00226448 predicted 636
9 SASI_Hs02_00343022 predicted 667
10 SASI_Hs02_00343023 predicted 789
11 SASI_Hs01_00226442 predicted 1672
12 SASI_Hs01_00226449 predicted 1704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007135
VALIDATED
ZNF79 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 79
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007135.1-1911s1c1
Sequence:CCGGCATGGTAGAAGTGGAGAGAGTCTCGAGACTCTCTCCACTTCTACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-735s1c1
Sequence:CCGGGCTGGAAGATTATATCTGGATCTCGAGATCCAGATATAATCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1184s1c1
Sequence:CCGGCAGAATGCCAACCTCACCAAACTCGAGTTTGGTGAGGTTGGCATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1603s1c1
Sequence:CCGGCCAGAGTACCAATCTCATAATCTCGAGATTATGAGATTGGTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1611s1c1
Sequence:CCGGCCAATCTCATAATCCACCAAACTCGAGTTTGGTGGATTATGAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-908s21c1
Sequence:CCGGTGGAAGCGAGACCTCGCAAATCTCGAGATTTGCGAGGTCTCGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007135.2-1757s21c1
Sequence:GTACCGGATGAGTGTGGTAAAGCGTTTACTCGAGTAAACGCTTTACCACACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-946s21c1
Sequence:CCGGAGCTTCAAGAACTCGGAAATCCTCGAGGATTTCCGAGTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007135.2-1912s21c1
Sequence:CCGGCTAGGAACATGGTAGAAGTGGCTCGAGCCACTTCTACCATGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-1442s21c1
Sequence:CCGGGTTACTGCGCAGCGTTCATTCCTCGAGGAATGAACGCTGCGCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007135
VALIDATED
ZNF79 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 79
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007135.1-1911s1c1
Sequence:CCGGCATGGTAGAAGTGGAGAGAGTCTCGAGACTCTCTCCACTTCTACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-735s1c1
Sequence:CCGGGCTGGAAGATTATATCTGGATCTCGAGATCCAGATATAATCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1184s1c1
Sequence:CCGGCAGAATGCCAACCTCACCAAACTCGAGTTTGGTGAGGTTGGCATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1603s1c1
Sequence:CCGGCCAGAGTACCAATCTCATAATCTCGAGATTATGAGATTGGTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1611s1c1
Sequence:CCGGCCAATCTCATAATCCACCAAACTCGAGTTTGGTGGATTATGAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-908s21c1
Sequence:CCGGTGGAAGCGAGACCTCGCAAATCTCGAGATTTGCGAGGTCTCGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007135.2-1757s21c1
Sequence:GTACCGGATGAGTGTGGTAAAGCGTTTACTCGAGTAAACGCTTTACCACACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-946s21c1
Sequence:CCGGAGCTTCAAGAACTCGGAAATCCTCGAGGATTTCCGAGTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007135.2-1912s21c1
Sequence:CCGGCTAGGAACATGGTAGAAGTGGCTCGAGCCACTTCTACCATGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-1442s21c1
Sequence:CCGGGTTACTGCGCAGCGTTCATTCCTCGAGGAATGAACGCTGCGCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007135
VALIDATED
ZNF79 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 79
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007135.1-1911s1c1
Sequence:CCGGCATGGTAGAAGTGGAGAGAGTCTCGAGACTCTCTCCACTTCTACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-735s1c1
Sequence:CCGGGCTGGAAGATTATATCTGGATCTCGAGATCCAGATATAATCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1184s1c1
Sequence:CCGGCAGAATGCCAACCTCACCAAACTCGAGTTTGGTGAGGTTGGCATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1603s1c1
Sequence:CCGGCCAGAGTACCAATCTCATAATCTCGAGATTATGAGATTGGTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007135.1-1611s1c1
Sequence:CCGGCCAATCTCATAATCCACCAAACTCGAGTTTGGTGGATTATGAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-908s21c1
Sequence:CCGGTGGAAGCGAGACCTCGCAAATCTCGAGATTTGCGAGGTCTCGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007135.2-1757s21c1
Sequence:GTACCGGATGAGTGTGGTAAAGCGTTTACTCGAGTAAACGCTTTACCACACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-946s21c1
Sequence:CCGGAGCTTCAAGAACTCGGAAATCCTCGAGGATTTCCGAGTTCTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007135.2-1912s21c1
Sequence:CCGGCTAGGAACATGGTAGAAGTGGCTCGAGCCACTTCTACCATGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007135.2-1442s21c1
Sequence:CCGGGTTACTGCGCAGCGTTCATTCCTCGAGGAATGAACGCTGCGCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks