EMAIL THIS PAGE TO A FRIEND

ZNF7

zinc finger protein 7

Synonyms: HF.16 KOX4 zf30
UniProtKB ID: P17097, D3DWN6, P17015
Gene ID:
cow(538537) zinc finger protein 7
cow(785799) zinc finger protein 7
domestic guinea pig(100714085) zinc finger protein 7
dog(475129) zinc finger protein 7
domestic cat(101083145) zinc finger protein 7
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003416 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335620 predicted 511
2 SASI_Hs02_00335621 predicted 668
3 SASI_Hs01_00023211 predicted 772
4 SASI_Hs02_00335622 predicted 491
5 SASI_Hs01_00023212 predicted 1129
6 SASI_Hs02_00335623 predicted 587
7 SASI_Hs01_00023213 predicted 875
8 SASI_Hs01_00023214 predicted 1937
9 SASI_Hs02_00335624 predicted 670
10 SASI_Hs01_00023215 predicted 778
11 SASI_Hs01_00023216 predicted 1852
12 SASI_Hs01_00023217 predicted 2297
13 SASI_Hs01_00023218 predicted 2296
14 SASI_Hs01_00023219 predicted 2304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003416
ZNF7 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-2069s21c1
Sequence:CCGGGTGGCGTTCACACCTAATTATCTCGAGATAATTAGGTGTGAACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-2046s21c1
Sequence:CCGGGAAGACTGTGAGAAGATATTTCTCGAGAAATATCTTCTCACAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-749s21c1
Sequence:CCGGCATCAGAGCCACTTCAGATATCTCGAGATATCTGAAGTGGCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-1572s21c1
Sequence:CCGGGTTCAGGGCTCACACCTTATTCTCGAGAATAAGGTGTGAGCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-419s21c1
Sequence:CCGGTGAGGACATGGACATCCTAAACTCGAGTTTAGGATGTCCATGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-477s1c1
Sequence:CCGGCCAAGACAGATTCTACGATTACTCGAGTAATCGTAGAATCTGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-1851s1c1
Sequence:CCGGCACAGCTTACAATACATCAAACTCGAGTTTGATGTATTGTAAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-872s1c1
Sequence:CCGGGCTCTGCATTGGGAAATTAATCTCGAGATTAATTTCCCAATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-1588s1c1
Sequence:CCGGTGGTTGTAGTTCACGGCTTATCTCGAGATAAGCCGTGAACTACAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-2093s1c1
Sequence:CCGGTCCACCTTTGTGAGCCGTAAACTCGAGTTTACGGCTCACAAAGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003416
ZNF7 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-2069s21c1
Sequence:CCGGGTGGCGTTCACACCTAATTATCTCGAGATAATTAGGTGTGAACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-2046s21c1
Sequence:CCGGGAAGACTGTGAGAAGATATTTCTCGAGAAATATCTTCTCACAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-749s21c1
Sequence:CCGGCATCAGAGCCACTTCAGATATCTCGAGATATCTGAAGTGGCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-1572s21c1
Sequence:CCGGGTTCAGGGCTCACACCTTATTCTCGAGAATAAGGTGTGAGCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-419s21c1
Sequence:CCGGTGAGGACATGGACATCCTAAACTCGAGTTTAGGATGTCCATGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-477s1c1
Sequence:CCGGCCAAGACAGATTCTACGATTACTCGAGTAATCGTAGAATCTGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-1851s1c1
Sequence:CCGGCACAGCTTACAATACATCAAACTCGAGTTTGATGTATTGTAAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-872s1c1
Sequence:CCGGGCTCTGCATTGGGAAATTAATCTCGAGATTAATTTCCCAATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-1588s1c1
Sequence:CCGGTGGTTGTAGTTCACGGCTTATCTCGAGATAAGCCGTGAACTACAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-2093s1c1
Sequence:CCGGTCCACCTTTGTGAGCCGTAAACTCGAGTTTACGGCTCACAAAGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003416
ZNF7 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-2069s21c1
Sequence:CCGGGTGGCGTTCACACCTAATTATCTCGAGATAATTAGGTGTGAACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-2046s21c1
Sequence:CCGGGAAGACTGTGAGAAGATATTTCTCGAGAAATATCTTCTCACAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-749s21c1
Sequence:CCGGCATCAGAGCCACTTCAGATATCTCGAGATATCTGAAGTGGCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-1572s21c1
Sequence:CCGGGTTCAGGGCTCACACCTTATTCTCGAGAATAAGGTGTGAGCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003416.2-419s21c1
Sequence:CCGGTGAGGACATGGACATCCTAAACTCGAGTTTAGGATGTCCATGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-477s1c1
Sequence:CCGGCCAAGACAGATTCTACGATTACTCGAGTAATCGTAGAATCTGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-1851s1c1
Sequence:CCGGCACAGCTTACAATACATCAAACTCGAGTTTGATGTATTGTAAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-872s1c1
Sequence:CCGGGCTCTGCATTGGGAAATTAATCTCGAGATTAATTTCCCAATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-1588s1c1
Sequence:CCGGTGGTTGTAGTTCACGGCTTATCTCGAGATAAGCCGTGAACTACAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003416.1-2093s1c1
Sequence:CCGGTCCACCTTTGTGAGCCGTAAACTCGAGTTTACGGCTCACAAAGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks