EMAIL THIS PAGE TO A FRIEND

ZNF800

zinc finger protein 800

UniProtKB ID: Q2TB10, Q9HBN0
Gene ID:
chicken(417747) zinc finger protein 800
Horse(100056562) zinc finger protein 800
domestic cat(101098367) zinc finger protein 800
dog(475207) zinc finger protein 800
cow(510277) zinc finger protein 800
sheep(101109169) zinc finger protein 800
domestic guinea pig(100715340) zinc finger protein 800
naked mole-rat(101726443) zinc finger protein 800
Domestic Rabbit(100328636) zinc finger protein 800
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023090 Anti-ZNF800 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102967 Anti-ZNF800 antibody produced in rabbit affinity isolated antibody rabbit, horse, mouse, canine, human, guinea pig, bovine, rat, rabbit
western blot pricing
HPA052194 Anti-ZNF800 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2104493 Anti-ZNF800, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, mouse, rabbit, bovine, human, guinea pig, horse, canine, zebrafish, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176814 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144621 MISSION® esiRNA esiRNA human ZNF800 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176814 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096065 predicted 1838
2 SASI_Hs01_00096067 predicted 2316
3 SASI_Hs01_00096068 predicted 1037
4 SASI_Hs02_00369236 predicted 1082
5 SASI_Hs01_00096069 predicted 1219
6 SASI_Hs01_00096071 predicted 1069
7 SASI_Hs02_00369237 predicted 1548
8 SASI_Hs01_00096072 predicted 1639
9 SASI_Hs01_00096073 predicted 1832
10 SASI_Hs02_00369238 predicted 1573
11 SASI_Hs01_00096064 predicted 1551
12 SASI_Hs01_00096066 predicted 876
13 SASI_Hs01_00096070 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176814
VALIDATED
ZNF800 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 800
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1574s21c1
Sequence:CCGGAGTTGTCCAGTATGTTGTAAACTCGAGTTTACAACATACTGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-2377s21c1
Sequence:CCGGTTTAGAGATCAGAGCTATAAACTCGAGTTTATAGCTCTGATCTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2911s21c1
Sequence:CCGGTTTCAAGTAGCTGTGATATTACTCGAGTAATATCACAGCTACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1082s21c1
Sequence:CCGGGTGGACAAACGAGAATATATTCTCGAGAATATATTCTCGTTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2974s21c1
Sequence:CCGGGTGCATTTGGTCGACAGTTTCCTCGAGGAAACTGTCGACCAAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1154s21c1
Sequence:CCGGTCGAGGACTGATAATCCTATTCTCGAGAATAGGATTATCAGTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-822s21c1
Sequence:CCGGAGACATCCAAATCTGGTATTCCTCGAGGAATACCAGATTTGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1010s21c1
Sequence:CCGGGACAACCTTCCTGATGTAAATCTCGAGATTTACATCAGGAAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-2521s21c1
Sequence:CCGGTGACGTCGGTATTGAAGTAAACTCGAGTTTACTTCAATACCGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2784s21c1
Sequence:CCGGACATCTTCAAATGGTACTATGCTCGAGCATAGTACCATTTGAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-759s21c1
Sequence:CCGGGATGCTGTGAACCAGTTTATACTCGAGTATAAACTGGTTCACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-1046s1c1
Sequence:CCGGGCCATAAATGATCTCCTAGAACTCGAGTTCTAGGAGATCATTTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_176814.3-1209s1c1
Sequence:CCGGCCGAAGTTCAGATACAGGAAACTCGAGTTTCCTGTATCTGAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-1706s1c1
Sequence:CCGGCTGGATTCTATTTCTCCTAAACTCGAGTTTAGGAGAAATAGAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-2147s1c1
Sequence:CCGGGCTGGCTTTGACTTTAAGCAACTCGAGTTGCTTAAAGTCAAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_176814.3-2306s1c1
Sequence:CCGGCGTGATGTGATACGACATATACTCGAGTATATGTCGTATCACATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176814
VALIDATED
ZNF800 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 800
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1574s21c1
Sequence:CCGGAGTTGTCCAGTATGTTGTAAACTCGAGTTTACAACATACTGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-2377s21c1
Sequence:CCGGTTTAGAGATCAGAGCTATAAACTCGAGTTTATAGCTCTGATCTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2911s21c1
Sequence:CCGGTTTCAAGTAGCTGTGATATTACTCGAGTAATATCACAGCTACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1082s21c1
Sequence:CCGGGTGGACAAACGAGAATATATTCTCGAGAATATATTCTCGTTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2974s21c1
Sequence:CCGGGTGCATTTGGTCGACAGTTTCCTCGAGGAAACTGTCGACCAAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1154s21c1
Sequence:CCGGTCGAGGACTGATAATCCTATTCTCGAGAATAGGATTATCAGTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-822s21c1
Sequence:CCGGAGACATCCAAATCTGGTATTCCTCGAGGAATACCAGATTTGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1010s21c1
Sequence:CCGGGACAACCTTCCTGATGTAAATCTCGAGATTTACATCAGGAAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-2521s21c1
Sequence:CCGGTGACGTCGGTATTGAAGTAAACTCGAGTTTACTTCAATACCGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2784s21c1
Sequence:CCGGACATCTTCAAATGGTACTATGCTCGAGCATAGTACCATTTGAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-759s21c1
Sequence:CCGGGATGCTGTGAACCAGTTTATACTCGAGTATAAACTGGTTCACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-1046s1c1
Sequence:CCGGGCCATAAATGATCTCCTAGAACTCGAGTTCTAGGAGATCATTTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_176814.3-1209s1c1
Sequence:CCGGCCGAAGTTCAGATACAGGAAACTCGAGTTTCCTGTATCTGAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-1706s1c1
Sequence:CCGGCTGGATTCTATTTCTCCTAAACTCGAGTTTAGGAGAAATAGAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-2147s1c1
Sequence:CCGGGCTGGCTTTGACTTTAAGCAACTCGAGTTGCTTAAAGTCAAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_176814.3-2306s1c1
Sequence:CCGGCGTGATGTGATACGACATATACTCGAGTATATGTCGTATCACATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176814
VALIDATED
ZNF800 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 800
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1574s21c1
Sequence:CCGGAGTTGTCCAGTATGTTGTAAACTCGAGTTTACAACATACTGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-2377s21c1
Sequence:CCGGTTTAGAGATCAGAGCTATAAACTCGAGTTTATAGCTCTGATCTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2911s21c1
Sequence:CCGGTTTCAAGTAGCTGTGATATTACTCGAGTAATATCACAGCTACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1082s21c1
Sequence:CCGGGTGGACAAACGAGAATATATTCTCGAGAATATATTCTCGTTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2974s21c1
Sequence:CCGGGTGCATTTGGTCGACAGTTTCCTCGAGGAAACTGTCGACCAAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1154s21c1
Sequence:CCGGTCGAGGACTGATAATCCTATTCTCGAGAATAGGATTATCAGTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-822s21c1
Sequence:CCGGAGACATCCAAATCTGGTATTCCTCGAGGAATACCAGATTTGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-1010s21c1
Sequence:CCGGGACAACCTTCCTGATGTAAATCTCGAGATTTACATCAGGAAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-2521s21c1
Sequence:CCGGTGACGTCGGTATTGAAGTAAACTCGAGTTTACTTCAATACCGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176814.3-2784s21c1
Sequence:CCGGACATCTTCAAATGGTACTATGCTCGAGCATAGTACCATTTGAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176814.3-759s21c1
Sequence:CCGGGATGCTGTGAACCAGTTTATACTCGAGTATAAACTGGTTCACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-1046s1c1
Sequence:CCGGGCCATAAATGATCTCCTAGAACTCGAGTTCTAGGAGATCATTTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_176814.3-1209s1c1
Sequence:CCGGCCGAAGTTCAGATACAGGAAACTCGAGTTTCCTGTATCTGAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-1706s1c1
Sequence:CCGGCTGGATTCTATTTCTCCTAAACTCGAGTTTAGGAGAAATAGAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176814.3-2147s1c1
Sequence:CCGGGCTGGCTTTGACTTTAAGCAACTCGAGTTGCTTAAAGTCAAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_176814.3-2306s1c1
Sequence:CCGGCGTGATGTGATACGACATATACTCGAGTATATGTCGTATCACATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks