EMAIL THIS PAGE TO A FRIEND

ZNF804A

zinc finger protein 804A

Synonyms: C2orf10
UniProtKB ID: Q7Z570, A7E253, Q6ZN26
Gene ID:
Zebrafish(565294) zinc finger protein 804A
chicken(423994) zinc finger protein 804A
domestic cat(101097575) zinc finger protein 804A
Horse(100054190) zinc finger protein 804A
dog(610934) zinc finger protein 804A
naked mole-rat(101721351) zinc finger protein 804A
domestic guinea pig(100729964) zinc finger protein 804A
cow(787276) zinc finger protein 804A
sheep(101116539) zinc finger protein 804A
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702531 Anti-ZNF804A antibody produced in rabbit affinity isolated antibody human
immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194250 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050531 MISSION® esiRNA esiRNA human ZNF804A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194250 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041802 predicted 3617
2 SASI_Hs01_00041803 predicted 1676
3 SASI_Hs02_00371366 predicted 1626
4 SASI_Hs01_00041804 predicted 3590
5 SASI_Hs01_00041805 predicted 1594
6 SASI_Hs01_00041807 predicted 4288
7 SASI_Hs01_00041808 predicted 1579
8 SASI_Hs01_00041809 predicted 4265
9 SASI_Hs01_00041810 predicted 2749
10 SASI_Hs01_00041811 predicted 2634
11 SASI_Hs01_00041806 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194250
ZNF804A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 804A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194250.1-4341s1c1
Sequence:CCGGGCGTCATTGGTTTGAAATCATCTCGAGATGATTTCAAACCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3485s1c1
Sequence:CCGGCACAGCCTAAATCCTATCTTTCTCGAGAAAGATAGGATTTAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-2072s1c1
Sequence:CCGGGCATGGGACCACTTTCAGATTCTCGAGAATCTGAAAGTGGTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3567s1c1
Sequence:CCGGGCTGCGTTATAATTCAGGAATCTCGAGATTCCTGAATTATAACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-1923s1c1
Sequence:CCGGGCTGGTTTATACAACTACGAACTCGAGTTCGTAGTTGTATAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3688s1c1
Sequence:CCGGCAAGCATTATTGATCCCACTACTCGAGTAGTGGGATCAATAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194250.1-2524s21c1
Sequence:CCGGTTAGCTGCAGAGCAATTATTACTCGAGTAATAATTGCTCTGCAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194250.1-1578s21c1
Sequence:CCGGAGTCCCATTAGCAGATCAAATCTCGAGATTTGATCTGCTAATGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194250
ZNF804A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 804A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194250.1-4341s1c1
Sequence:CCGGGCGTCATTGGTTTGAAATCATCTCGAGATGATTTCAAACCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3485s1c1
Sequence:CCGGCACAGCCTAAATCCTATCTTTCTCGAGAAAGATAGGATTTAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-2072s1c1
Sequence:CCGGGCATGGGACCACTTTCAGATTCTCGAGAATCTGAAAGTGGTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3567s1c1
Sequence:CCGGGCTGCGTTATAATTCAGGAATCTCGAGATTCCTGAATTATAACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-1923s1c1
Sequence:CCGGGCTGGTTTATACAACTACGAACTCGAGTTCGTAGTTGTATAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3688s1c1
Sequence:CCGGCAAGCATTATTGATCCCACTACTCGAGTAGTGGGATCAATAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194250.1-2524s21c1
Sequence:CCGGTTAGCTGCAGAGCAATTATTACTCGAGTAATAATTGCTCTGCAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194250.1-1578s21c1
Sequence:CCGGAGTCCCATTAGCAGATCAAATCTCGAGATTTGATCTGCTAATGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194250
ZNF804A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 804A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194250.1-4341s1c1
Sequence:CCGGGCGTCATTGGTTTGAAATCATCTCGAGATGATTTCAAACCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3485s1c1
Sequence:CCGGCACAGCCTAAATCCTATCTTTCTCGAGAAAGATAGGATTTAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-2072s1c1
Sequence:CCGGGCATGGGACCACTTTCAGATTCTCGAGAATCTGAAAGTGGTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3567s1c1
Sequence:CCGGGCTGCGTTATAATTCAGGAATCTCGAGATTCCTGAATTATAACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-1923s1c1
Sequence:CCGGGCTGGTTTATACAACTACGAACTCGAGTTCGTAGTTGTATAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194250.1-3688s1c1
Sequence:CCGGCAAGCATTATTGATCCCACTACTCGAGTAGTGGGATCAATAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194250.1-2524s21c1
Sequence:CCGGTTAGCTGCAGAGCAATTATTACTCGAGTAATAATTGCTCTGCAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194250.1-1578s21c1
Sequence:CCGGAGTCCCATTAGCAGATCAAATCTCGAGATTTGATCTGCTAATGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks