EMAIL THIS PAGE TO A FRIEND

ZNF804B

zinc finger protein 804B

UniProtKB ID: A4D1E1, B2RTV2, Q7Z714, Q96MN7
Gene ID:
cow(100295505) zinc finger protein 804B
sheep(101111449) zinc finger protein 804B
domestic guinea pig(100728906) zinc finger protein 804B
naked mole-rat(101703796) zinc finger protein 804B
Domestic Rabbit(100357136) zinc finger protein 804B
chicken(420539) zinc finger protein 804B
Horse(100050456) zinc finger protein 804B
dog(482288) zinc finger protein 804B
domestic cat(101101631) zinc finger protein 804B
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181646 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181646 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370221 predicted 1461
2 SASI_Hs02_00370222 predicted 2488
3 SASI_Hs01_00166718 predicted 4053
4 SASI_Hs01_00166719 predicted 3877
5 SASI_Hs01_00166720 predicted 3919
6 SASI_Hs02_00370223 predicted 2932
7 SASI_Hs02_00370224 predicted 2138
8 SASI_Hs01_00166722 predicted 3914
9 SASI_Hs01_00166723 predicted 1087
10 SASI_Hs01_00166726 predicted 2147
11 SASI_Hs01_00166717 predicted 3034
12 SASI_Hs01_00166721 predicted 1476
13 SASI_Hs01_00166724 predicted 820
14 SASI_Hs01_00166725 predicted 1419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181646
ZNF804B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 804B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-3095s21c1
Sequence:CCGGAGATTGGACTCTTACTCAATACTCGAGTATTGAGTAAGAGTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-4286s21c1
Sequence:CCGGACTCTGACTCCAACCATTATCCTCGAGGATAATGGTTGGAGTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-806s21c1
Sequence:CCGGCAACGGGAATTTGCTCGAAATCTCGAGATTTCGAGCAAATTCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-3926s1c1
Sequence:CCGGGACGGATTAGAAATGTGTCATCTCGAGATGACACATTTCTAATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-2144s1c1
Sequence:CCGGCCAAAGACGATGATAGCTAATCTCGAGATTAGCTATCATCGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-3426s1c1
Sequence:CCGGGCACAATTCAACTTGCACCATCTCGAGATGGTGCAAGTTGAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-1447s1c1
Sequence:CCGGGCAAGACAAACACGACTCTATCTCGAGATAGAGTCGTGTTTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-2420s1c1
Sequence:CCGGCCTTCCTACATCTCTAGGTTTCTCGAGAAACCTAGAGATGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181646.2-1448s1c1
Sequence:CCGGCAAGACAAACACGACTCTATTCTCGAGAATAGAGTCGTGTTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181646
ZNF804B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 804B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-3095s21c1
Sequence:CCGGAGATTGGACTCTTACTCAATACTCGAGTATTGAGTAAGAGTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-4286s21c1
Sequence:CCGGACTCTGACTCCAACCATTATCCTCGAGGATAATGGTTGGAGTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-806s21c1
Sequence:CCGGCAACGGGAATTTGCTCGAAATCTCGAGATTTCGAGCAAATTCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-3926s1c1
Sequence:CCGGGACGGATTAGAAATGTGTCATCTCGAGATGACACATTTCTAATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-2144s1c1
Sequence:CCGGCCAAAGACGATGATAGCTAATCTCGAGATTAGCTATCATCGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-3426s1c1
Sequence:CCGGGCACAATTCAACTTGCACCATCTCGAGATGGTGCAAGTTGAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-1447s1c1
Sequence:CCGGGCAAGACAAACACGACTCTATCTCGAGATAGAGTCGTGTTTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-2420s1c1
Sequence:CCGGCCTTCCTACATCTCTAGGTTTCTCGAGAAACCTAGAGATGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181646.2-1448s1c1
Sequence:CCGGCAAGACAAACACGACTCTATTCTCGAGAATAGAGTCGTGTTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181646
ZNF804B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 804B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-3095s21c1
Sequence:CCGGAGATTGGACTCTTACTCAATACTCGAGTATTGAGTAAGAGTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-4286s21c1
Sequence:CCGGACTCTGACTCCAACCATTATCCTCGAGGATAATGGTTGGAGTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181646.2-806s21c1
Sequence:CCGGCAACGGGAATTTGCTCGAAATCTCGAGATTTCGAGCAAATTCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-3926s1c1
Sequence:CCGGGACGGATTAGAAATGTGTCATCTCGAGATGACACATTTCTAATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-2144s1c1
Sequence:CCGGCCAAAGACGATGATAGCTAATCTCGAGATTAGCTATCATCGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-3426s1c1
Sequence:CCGGGCACAATTCAACTTGCACCATCTCGAGATGGTGCAAGTTGAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-1447s1c1
Sequence:CCGGGCAAGACAAACACGACTCTATCTCGAGATAGAGTCGTGTTTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181646.2-2420s1c1
Sequence:CCGGCCTTCCTACATCTCTAGGTTTCTCGAGAAACCTAGAGATGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181646.2-1448s1c1
Sequence:CCGGCAAGACAAACACGACTCTATTCTCGAGAATAGAGTCGTGTTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks