EMAIL THIS PAGE TO A FRIEND

ZNF805

zinc finger protein 805

UniProtKB ID: Q5CZA5, B4DNM5
Gene ID:
domestic cat(101095625) zinc finger protein 805
naked mole-rat(101717170) zinc finger protein 805
domestic guinea pig(100735137) zinc finger protein 805
cow(100336812) zinc finger protein 805
cow(788187) zinc finger protein 264-like
cow(540454) zinc finger protein 805
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001023563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023563 Rosetta Predictions human pricing
XM_001718504 Rosetta Predictions human pricing
XM_001718548 Rosetta Predictions human pricing
XM_001719150 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111069 predicted 445
2 SASI_Hs01_00111070 predicted 1304
3 SASI_Hs01_00111071 predicted 1332
4 SASI_Hs01_00111072 predicted 1222
5 SASI_Hs01_00111073 predicted 664
6 SASI_Hs01_00111074 predicted 1275
7 SASI_Hs01_00111075 predicted 1302
8 SASI_Hs01_00111076 predicted 1341
9 SASI_Hs01_00111077 predicted 1342
10 SASI_Hs01_00111078 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424377 predicted 1062
2 SASI_Hs02_00424378 predicted 1833
3 SASI_Hs02_00424379 predicted 370
4 SASI_Hs02_00424380 predicted 708
5 SASI_Hs02_00424381 predicted 1274
6 SASI_Hs02_00424382 predicted 551
7 SASI_Hs02_00424383 predicted 502
8 SASI_Hs02_00424384 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424684 predicted 1060
2 SASI_Hs02_00424685 predicted 1830
3 SASI_Hs02_00424686 predicted 365
4 SASI_Hs02_00424687 predicted 709
5 SASI_Hs02_00424688 predicted 1280
6 SASI_Hs02_00424689 predicted 554
7 SASI_Hs02_00424690 predicted 501
8 SASI_Hs02_00424691 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00428538 predicted 1104
2 SASI_Hs02_00428539 predicted 1879
3 SASI_Hs02_00428540 predicted 418
4 SASI_Hs02_00428541 predicted 758
5 SASI_Hs02_00428542 predicted 1325
6 SASI_Hs02_00428543 predicted 601
7 SASI_Hs02_00428544 predicted 547
8 SASI_Hs02_00428545 predicted 1886
9 SASI_Hs02_00428546 predicted 64
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023563
ZNF805 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 805
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-366s1c1
Sequence:CCGGGCCAGGTTTCATTCGACACTACTCGAGTAGTGTCGAATGAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001023563.1-3657s1c1
Sequence:CCGGCCCTGCTATTTGTTATTGATTCTCGAGAATCAATAACAAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-891s1c1
Sequence:CCGGGCGGATTCATAGTGGAGAGAACTCGAGTTCTCTCCACTATGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-1202s1c1
Sequence:CCGGAGGAAGCATCTTACATGGCATCTCGAGATGCCATGTAAGATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-1225s1c1
Sequence:CCGGGATCGTACATACCAAAGAGAACTCGAGTTCTCTTTGGTATGTACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023563.3-2148s21c1
Sequence:CCGGACGCAGCTTAGAGCCTTATTCCTCGAGGAATAAGGCTCTAAGCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023563.3-763s21c1
Sequence:CCGGGACTCACATGGATCAGGTAAACTCGAGTTTACCTGATCCATGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023563.3-2389s21c1
Sequence:CCGGGGTCTGGAAACTTACTCAATGCTCGAGCATTGAGTAAGTTTCCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023563
ZNF805 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 805
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-366s1c1
Sequence:CCGGGCCAGGTTTCATTCGACACTACTCGAGTAGTGTCGAATGAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001023563.1-3657s1c1
Sequence:CCGGCCCTGCTATTTGTTATTGATTCTCGAGAATCAATAACAAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-891s1c1
Sequence:CCGGGCGGATTCATAGTGGAGAGAACTCGAGTTCTCTCCACTATGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-1202s1c1
Sequence:CCGGAGGAAGCATCTTACATGGCATCTCGAGATGCCATGTAAGATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-1225s1c1
Sequence:CCGGGATCGTACATACCAAAGAGAACTCGAGTTCTCTTTGGTATGTACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023563.3-2148s21c1
Sequence:CCGGACGCAGCTTAGAGCCTTATTCCTCGAGGAATAAGGCTCTAAGCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023563.3-763s21c1
Sequence:CCGGGACTCACATGGATCAGGTAAACTCGAGTTTACCTGATCCATGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023563.3-2389s21c1
Sequence:CCGGGGTCTGGAAACTTACTCAATGCTCGAGCATTGAGTAAGTTTCCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023563
ZNF805 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 805
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-366s1c1
Sequence:CCGGGCCAGGTTTCATTCGACACTACTCGAGTAGTGTCGAATGAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001023563.1-3657s1c1
Sequence:CCGGCCCTGCTATTTGTTATTGATTCTCGAGAATCAATAACAAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-891s1c1
Sequence:CCGGGCGGATTCATAGTGGAGAGAACTCGAGTTCTCTCCACTATGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-1202s1c1
Sequence:CCGGAGGAAGCATCTTACATGGCATCTCGAGATGCCATGTAAGATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023563.1-1225s1c1
Sequence:CCGGGATCGTACATACCAAAGAGAACTCGAGTTCTCTTTGGTATGTACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023563.3-2148s21c1
Sequence:CCGGACGCAGCTTAGAGCCTTATTCCTCGAGGAATAAGGCTCTAAGCTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023563.3-763s21c1
Sequence:CCGGGACTCACATGGATCAGGTAAACTCGAGTTTACCTGATCCATGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023563.3-2389s21c1
Sequence:CCGGGGTCTGGAAACTTACTCAATGCTCGAGCATTGAGTAAGTTTCCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks