EMAIL THIS PAGE TO A FRIEND

ZNF806

zinc finger protein 806

Species: Human ZNF806(646915)
UniProtKB ID: P0C7X5
Gene ID:
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301814 ANTI-ZNF806 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001715118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001715118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001715118 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715118 Rosetta Predictions human pricing
XM_001724242 Rosetta Predictions human pricing
XM_497879 Rosetta Predictions human pricing
XM_929878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401587 predicted 475
2 SASI_Hs02_00401588 predicted 840
3 SASI_Hs02_00401589 predicted 1029
4 SASI_Hs02_00401590 predicted 806
5 SASI_Hs02_00401591 predicted 1034
6 SASI_Hs02_00401592 predicted 425
7 SASI_Hs02_00401593 predicted 423
8 SASI_Hs02_00401594 predicted 1490
9 SASI_Hs02_00401595 predicted 654
10 SASI_Hs02_00401596 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00460392 predicted 1033
2 SASI_Hs02_00460393 predicted 1035
3 SASI_Hs02_00460394 predicted 641
4 SASI_Hs02_00460395 predicted 422
5 SASI_Hs02_00460396 predicted 416
6 SASI_Hs02_00460397 predicted 1572
7 SASI_Hs02_00460398 predicted 1672
8 SASI_Hs02_00460399 predicted 121
9 SASI_Hs02_00460400 predicted 176
10 SASI_Hs02_00460401 predicted 25
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480138 predicted 1026
2 SASI_Hs02_00480139 predicted 1030
3 SASI_Hs02_00480140 predicted 422
4 SASI_Hs02_00480141 predicted 417
5 SASI_Hs02_00480142 predicted 639
6 SASI_Hs02_00480143 predicted 1568
7 SASI_Hs02_00480144 predicted 1673
8 SASI_Hs02_00480145 predicted 29
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267342 predicted 794
2 SASI_Hs01_00267343 predicted 913
3 SASI_Hs01_00267344 predicted 853
4 SASI_Hs01_00267345 predicted 103
5 SASI_Hs01_00267346 predicted 312
6 SASI_Hs01_00267347 predicted 66
7 SASI_Hs01_00267348 predicted 172
8 SASI_Hs01_00267349 predicted 764
9 SASI_Hs01_00267350 predicted 961
10 SASI_Hs01_00267351 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001715118
ZNF806 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 806
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-1599s21c1
Sequence:CCGGAGAGGACAGAGGCCCTATAAGCTCGAGCTTATAGGGCCTCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-842s21c1
Sequence:CCGGACTCAAGAGAGACTCCCTATGCTCGAGCATAGGGAGTCTCTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-132s21c1
Sequence:CCGGCATCTCAGTGGACGGGATTAACTCGAGTTAATCCCGTCCACTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-1022s21c1
Sequence:CCGGGCCCTACAAATGCCACGTATGCTCGAGCATACGTGGCATTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-928s21c1
Sequence:CCGGTCAGGAGACAATCCTACAAATCTCGAGATTTGTAGGATTGTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001715118
ZNF806 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 806
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-1599s21c1
Sequence:CCGGAGAGGACAGAGGCCCTATAAGCTCGAGCTTATAGGGCCTCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-842s21c1
Sequence:CCGGACTCAAGAGAGACTCCCTATGCTCGAGCATAGGGAGTCTCTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-132s21c1
Sequence:CCGGCATCTCAGTGGACGGGATTAACTCGAGTTAATCCCGTCCACTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-1022s21c1
Sequence:CCGGGCCCTACAAATGCCACGTATGCTCGAGCATACGTGGCATTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-928s21c1
Sequence:CCGGTCAGGAGACAATCCTACAAATCTCGAGATTTGTAGGATTGTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001715118
ZNF806 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 806
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-1599s21c1
Sequence:CCGGAGAGGACAGAGGCCCTATAAGCTCGAGCTTATAGGGCCTCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-842s21c1
Sequence:CCGGACTCAAGAGAGACTCCCTATGCTCGAGCATAGGGAGTCTCTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-132s21c1
Sequence:CCGGCATCTCAGTGGACGGGATTAACTCGAGTTAATCCCGTCCACTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-1022s21c1
Sequence:CCGGGCCCTACAAATGCCACGTATGCTCGAGCATACGTGGCATTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715118.1-928s21c1
Sequence:CCGGTCAGGAGACAATCCTACAAATCTCGAGATTTGTAGGATTGTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks