EMAIL THIS PAGE TO A FRIEND

ZNF808

zinc finger protein 808

UniProtKB ID: Q8N4W9, Q68CN7
Gene ID:
dog(476394) zinc finger protein 808
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039886 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106941 MISSION® esiRNA esiRNA human ZNF808 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039886 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308698 predicted 1832
2 SASI_Hs02_00308699 predicted 2862
3 SASI_Hs02_00308700 predicted 2864
4 SASI_Hs02_00308701 predicted 1987
5 SASI_Hs02_00308702 predicted 1768
6 SASI_Hs02_00308703 predicted 2165
7 SASI_Hs02_00308704 predicted 2910
8 SASI_Hs02_00308705 predicted 2875
9 SASI_Hs02_00308706 predicted 1818
10 SASI_Hs02_00308707 predicted 2318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039886
ZNF808 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 808
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1740s21c1
Sequence:CCGGTCACCGGGCATCCCTTGTATACTCGAGTATACAAGGGATGCCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-2237s21c1
Sequence:CCGGCTTTCGTGTGTCGTTCCTATGCTCGAGCATAGGAACGACACACGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1774s21c1
Sequence:GTACCGGCACACTCTAGAGAAATCTTACCTCGAGGTAAGATTTCTCTAGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-2867s21c1
Sequence:CCGGATGGTATAGGGAAATTTGATTCTCGAGAATCAAATTTCCCTATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1558s21c1
Sequence:CCGGGATACAGCTTTCACGTGTAATCTCGAGATTACACGTGAAAGCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039886
ZNF808 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 808
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1740s21c1
Sequence:CCGGTCACCGGGCATCCCTTGTATACTCGAGTATACAAGGGATGCCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-2237s21c1
Sequence:CCGGCTTTCGTGTGTCGTTCCTATGCTCGAGCATAGGAACGACACACGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1774s21c1
Sequence:GTACCGGCACACTCTAGAGAAATCTTACCTCGAGGTAAGATTTCTCTAGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-2867s21c1
Sequence:CCGGATGGTATAGGGAAATTTGATTCTCGAGAATCAAATTTCCCTATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1558s21c1
Sequence:CCGGGATACAGCTTTCACGTGTAATCTCGAGATTACACGTGAAAGCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039886
ZNF808 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 808
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1740s21c1
Sequence:CCGGTCACCGGGCATCCCTTGTATACTCGAGTATACAAGGGATGCCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-2237s21c1
Sequence:CCGGCTTTCGTGTGTCGTTCCTATGCTCGAGCATAGGAACGACACACGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1774s21c1
Sequence:GTACCGGCACACTCTAGAGAAATCTTACCTCGAGGTAAGATTTCTCTAGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-2867s21c1
Sequence:CCGGATGGTATAGGGAAATTTGATTCTCGAGAATCAAATTTCCCTATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039886.3-1558s21c1
Sequence:CCGGGATACAGCTTTCACGTGTAATCTCGAGATTACACGTGAAAGCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks