EMAIL THIS PAGE TO A FRIEND

ZNF80

zinc finger protein 80

Synonyms: pT17
Species: Human ZNF80(7634), domestic cat ZNF80(101098079)
UniProtKB ID: P51504, Q6NSW4, Q6NT14
Gene ID:
domestic cat(101098079) zinc finger protein 80
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007136 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107791 MISSION® esiRNA esiRNA human AC093323.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007136 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010851 predicted 656
2 SASI_Hs01_00010852 predicted 812
3 SASI_Hs01_00010853 predicted 772
4 SASI_Hs01_00010854 predicted 923
5 SASI_Hs01_00010855 predicted 1022
6 SASI_Hs01_00010856 predicted 657
7 SASI_Hs01_00010857 predicted 927
8 SASI_Hs01_00010858 predicted 933
9 SASI_Hs01_00010859 predicted 918
10 SASI_Hs01_00010860 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007136
ZNF80 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 80
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-1335s1c1
Sequence:CCGGGTGCAAATGATGTGGGAATTTCTCGAGAAATTCCCACATCATTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-1253s1c1
Sequence:CCGGCCTTGAACATAGAAAGGACTTCTCGAGAAGTCCTTTCTATGTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-621s1c1
Sequence:CCGGCCAAGTAAAGACACTTTGGTTCTCGAGAACCAAAGTGTCTTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-938s1c1
Sequence:CCGGCAGCTATCACTCTGTCTTCATCTCGAGATGAAGACAGAGTGATAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007136.1-2217s1c1
Sequence:CCGGCGTTGAGACAATCTAAATGTTCTCGAGAACATTTAGATTGTCTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007136.3-1479s21c1
Sequence:CCGGGAGATAAACTCTATGAGATATCTCGAGATATCTCATAGAGTTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007136
ZNF80 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 80
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-1335s1c1
Sequence:CCGGGTGCAAATGATGTGGGAATTTCTCGAGAAATTCCCACATCATTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-1253s1c1
Sequence:CCGGCCTTGAACATAGAAAGGACTTCTCGAGAAGTCCTTTCTATGTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-621s1c1
Sequence:CCGGCCAAGTAAAGACACTTTGGTTCTCGAGAACCAAAGTGTCTTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-938s1c1
Sequence:CCGGCAGCTATCACTCTGTCTTCATCTCGAGATGAAGACAGAGTGATAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007136.1-2217s1c1
Sequence:CCGGCGTTGAGACAATCTAAATGTTCTCGAGAACATTTAGATTGTCTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007136.3-1479s21c1
Sequence:CCGGGAGATAAACTCTATGAGATATCTCGAGATATCTCATAGAGTTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007136
ZNF80 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 80
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-1335s1c1
Sequence:CCGGGTGCAAATGATGTGGGAATTTCTCGAGAAATTCCCACATCATTTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-1253s1c1
Sequence:CCGGCCTTGAACATAGAAAGGACTTCTCGAGAAGTCCTTTCTATGTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-621s1c1
Sequence:CCGGCCAAGTAAAGACACTTTGGTTCTCGAGAACCAAAGTGTCTTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007136.1-938s1c1
Sequence:CCGGCAGCTATCACTCTGTCTTCATCTCGAGATGAAGACAGAGTGATAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007136.1-2217s1c1
Sequence:CCGGCGTTGAGACAATCTAAATGTTCTCGAGAACATTTAGATTGTCTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007136.3-1479s21c1
Sequence:CCGGGAGATAAACTCTATGAGATATCTCGAGATATCTCATAGAGTTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks