EMAIL THIS PAGE TO A FRIEND

ZNF813

zinc finger protein 813

UniProtKB ID: Q6ZN06
Gene ID:
cow(616954) zinc finger protein 347
cow(100139360) zinc finger protein 813
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004301 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076479 predicted 872
2 SASI_Hs01_00076480 predicted 1555
3 SASI_Hs01_00076481 predicted 970
4 SASI_Hs02_00304491 predicted 373
5 SASI_Hs02_00304492 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004301
ZNF813 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 813
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1253s1c1
Sequence:CCGGGTAATGAATGTGGCAAGGTTTCTCGAGAAACCTTGCCACATTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1123s1c1
Sequence:CCGGCTTGCACATCATCATAGACTTCTCGAGAAGTCTATGATGATGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-313s1c1
Sequence:CCGGGAGAAACCTTACAGGTGTAATCTCGAGATTACACCTGTAAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-868s1c1
Sequence:CCGGGCCCTTGTAATTCATAAGGCTCTCGAGAGCCTTATGAATTACAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1126s1c1
Sequence:CCGGGCACATCATCATAGACTTCATCTCGAGATGAAGTCTATGATGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-1549s21c1
Sequence:CCGGAGACGTTCAGTCGAATTTCAGCTCGAGCTGAAATTCGACTGAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-383s21c1
Sequence:CCGGTCGCTTTCAGGAAATTGATAACTCGAGTTATCAATTTCCTGAAAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-899s21c1
Sequence:CCGGCCTAGTGTGCCATCGTAGATGCTCGAGCATCTACGATGGCACACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-492s21c1
Sequence:CCGGAGTGCAGACCGATATGATCAACTCGAGTTGATCATATCGGTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004301
ZNF813 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 813
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1253s1c1
Sequence:CCGGGTAATGAATGTGGCAAGGTTTCTCGAGAAACCTTGCCACATTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1123s1c1
Sequence:CCGGCTTGCACATCATCATAGACTTCTCGAGAAGTCTATGATGATGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-313s1c1
Sequence:CCGGGAGAAACCTTACAGGTGTAATCTCGAGATTACACCTGTAAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-868s1c1
Sequence:CCGGGCCCTTGTAATTCATAAGGCTCTCGAGAGCCTTATGAATTACAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1126s1c1
Sequence:CCGGGCACATCATCATAGACTTCATCTCGAGATGAAGTCTATGATGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-1549s21c1
Sequence:CCGGAGACGTTCAGTCGAATTTCAGCTCGAGCTGAAATTCGACTGAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-383s21c1
Sequence:CCGGTCGCTTTCAGGAAATTGATAACTCGAGTTATCAATTTCCTGAAAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-899s21c1
Sequence:CCGGCCTAGTGTGCCATCGTAGATGCTCGAGCATCTACGATGGCACACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-492s21c1
Sequence:CCGGAGTGCAGACCGATATGATCAACTCGAGTTGATCATATCGGTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004301
ZNF813 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 813
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1253s1c1
Sequence:CCGGGTAATGAATGTGGCAAGGTTTCTCGAGAAACCTTGCCACATTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1123s1c1
Sequence:CCGGCTTGCACATCATCATAGACTTCTCGAGAAGTCTATGATGATGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-313s1c1
Sequence:CCGGGAGAAACCTTACAGGTGTAATCTCGAGATTACACCTGTAAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-868s1c1
Sequence:CCGGGCCCTTGTAATTCATAAGGCTCTCGAGAGCCTTATGAATTACAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004301.1-1126s1c1
Sequence:CCGGGCACATCATCATAGACTTCATCTCGAGATGAAGTCTATGATGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-1549s21c1
Sequence:CCGGAGACGTTCAGTCGAATTTCAGCTCGAGCTGAAATTCGACTGAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-383s21c1
Sequence:CCGGTCGCTTTCAGGAAATTGATAACTCGAGTTATCAATTTCCTGAAAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-899s21c1
Sequence:CCGGCCTAGTGTGCCATCGTAGATGCTCGAGCATCTACGATGGCACACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004301.3-492s21c1
Sequence:CCGGAGTGCAGACCGATATGATCAACTCGAGTTGATCATATCGGTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks