EMAIL THIS PAGE TO A FRIEND

ZNF814

zinc finger protein 814

UniProtKB ID: B7Z6K7, A6NF35
Gene ID:
cow(613566) zinc finger protein 814
domestic cat(101092471) zinc finger protein 814
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144989 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725674 Rosetta Predictions human pricing
XM_001725708 Rosetta Predictions human pricing
XM_001726286 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469255 predicted 2387
2 SASI_Hs02_00469256 predicted 2388
3 SASI_Hs02_00469257 predicted 2733
4 SASI_Hs02_00469258 predicted 1961
5 SASI_Hs02_00469259 predicted 1931
6 SASI_Hs02_00469260 predicted 1913
7 SASI_Hs02_00469261 predicted 1882
8 SASI_Hs02_00469262 predicted 1848
9 SASI_Hs02_00469263 predicted 1823
10 SASI_Hs02_00469264 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469459 predicted 2377
2 SASI_Hs02_00469460 predicted 2380
3 SASI_Hs02_00469461 predicted 2730
4 SASI_Hs02_00469462 predicted 1955
5 SASI_Hs02_00469463 predicted 1931
6 SASI_Hs02_00469464 predicted 1911
7 SASI_Hs02_00469465 predicted 1882
8 SASI_Hs02_00469466 predicted 1845
9 SASI_Hs02_00469467 predicted 1814
10 SASI_Hs02_00469468 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00473297 predicted 2379
2 SASI_Hs02_00473298 predicted 2389
3 SASI_Hs02_00473299 predicted 2737
4 SASI_Hs02_00473300 predicted 1966
5 SASI_Hs02_00473301 predicted 1926
6 SASI_Hs02_00473302 predicted 1919
7 SASI_Hs02_00473303 predicted 1879
8 SASI_Hs02_00473304 predicted 1841
9 SASI_Hs02_00473305 predicted 1823
10 SASI_Hs02_00473306 predicted 2392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144989
ZNF814 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 814
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-1875s21c1
Sequence:CCGGCTTAGGAACCATCAGCAAATTCTCGAGAATTTGCTGATGGTTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144989.1-3038s21c1
Sequence:CCGGGAAACTTTCAGTCTCATTAAACTCGAGTTTAATGAGACTGAAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-978s21c1
Sequence:CCGGCTCACTAGAGAAGAGTGTTATCTCGAGATAACACTCTTCTCTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-1607s21c1
Sequence:CCGGTAGTTCAGAAGGACATCTTAGCTCGAGCTAAGATGTCCTTCTGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-2613s21c1
Sequence:CCGGTTCGCTGAAAGCTCCAGTTTCCTCGAGGAAACTGGAGCTTTCAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144989
ZNF814 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 814
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-1875s21c1
Sequence:CCGGCTTAGGAACCATCAGCAAATTCTCGAGAATTTGCTGATGGTTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144989.1-3038s21c1
Sequence:CCGGGAAACTTTCAGTCTCATTAAACTCGAGTTTAATGAGACTGAAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-978s21c1
Sequence:CCGGCTCACTAGAGAAGAGTGTTATCTCGAGATAACACTCTTCTCTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-1607s21c1
Sequence:CCGGTAGTTCAGAAGGACATCTTAGCTCGAGCTAAGATGTCCTTCTGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-2613s21c1
Sequence:CCGGTTCGCTGAAAGCTCCAGTTTCCTCGAGGAAACTGGAGCTTTCAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144989
ZNF814 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 814
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-1875s21c1
Sequence:CCGGCTTAGGAACCATCAGCAAATTCTCGAGAATTTGCTGATGGTTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144989.1-3038s21c1
Sequence:CCGGGAAACTTTCAGTCTCATTAAACTCGAGTTTAATGAGACTGAAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-978s21c1
Sequence:CCGGCTCACTAGAGAAGAGTGTTATCTCGAGATAACACTCTTCTCTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-1607s21c1
Sequence:CCGGTAGTTCAGAAGGACATCTTAGCTCGAGCTAAGATGTCCTTCTGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144989.1-2613s21c1
Sequence:CCGGTTCGCTGAAAGCTCCAGTTTCCTCGAGGAAACTGGAGCTTTCAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks