EMAIL THIS PAGE TO A FRIEND

ZNF815P

zinc finger protein 815, pseudogene

Synonyms: ZNF815
Species: Human ZNF815P(401303)
UniProtKB ID: A8K554
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001714535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_023382 Rosetta Predictions human pricing
XM_928774 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381882 predicted 1226
2 SASI_Hs02_00381883 predicted 355
3 SASI_Hs02_00381884 predicted 1352
4 SASI_Hs02_00381885 predicted 798
5 SASI_Hs02_00381886 predicted 768
6 SASI_Hs02_00381887 predicted 1232
7 SASI_Hs02_00381888 predicted 847
8 SASI_Hs02_00381889 predicted 669
9 SASI_Hs02_00381890 predicted 1262
10 SASI_Hs02_00381891 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262541 predicted 404
2 SASI_Hs01_00262542 predicted 777
3 SASI_Hs01_00262543 predicted 393
4 SASI_Hs01_00262544 predicted 808
5 SASI_Hs01_00262545 predicted 767
6 SASI_Hs01_00262546 predicted 396
7 SASI_Hs01_00262547 predicted 674
8 SASI_Hs01_00262548 predicted 789
9 SASI_Hs01_00262549 predicted 791
10 SASI_Hs01_00262550 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714535
ZNF815P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 815, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-103s21c1
Sequence:CCGGACTCTTCCTACGGCGACTGACCTCGAGGTCAGTCGCCGTAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-71s21c1
Sequence:CCGGAGGACTGCAATGCGCGCACTTCTCGAGAAGTGCGCGCATTGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-357s21c1
Sequence:CCGGACCGTCCTCTGGAAGCTTGTGCTCGAGCACAAGCTTCCAGAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-429s21c1
Sequence:CCGGACAGCAAGGAAGAACCATGGCCTCGAGGCCATGGTTCTTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-403s21c1
Sequence:CCGGTGGACGCAGATACCTGCTTTCCTCGAGGAAAGCAGGTATCTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714535
ZNF815P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 815, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-103s21c1
Sequence:CCGGACTCTTCCTACGGCGACTGACCTCGAGGTCAGTCGCCGTAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-71s21c1
Sequence:CCGGAGGACTGCAATGCGCGCACTTCTCGAGAAGTGCGCGCATTGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-357s21c1
Sequence:CCGGACCGTCCTCTGGAAGCTTGTGCTCGAGCACAAGCTTCCAGAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-429s21c1
Sequence:CCGGACAGCAAGGAAGAACCATGGCCTCGAGGCCATGGTTCTTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-403s21c1
Sequence:CCGGTGGACGCAGATACCTGCTTTCCTCGAGGAAAGCAGGTATCTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714535
ZNF815P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 815, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-103s21c1
Sequence:CCGGACTCTTCCTACGGCGACTGACCTCGAGGTCAGTCGCCGTAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-71s21c1
Sequence:CCGGAGGACTGCAATGCGCGCACTTCTCGAGAAGTGCGCGCATTGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-357s21c1
Sequence:CCGGACCGTCCTCTGGAAGCTTGTGCTCGAGCACAAGCTTCCAGAGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-429s21c1
Sequence:CCGGACAGCAAGGAAGAACCATGGCCTCGAGGCCATGGTTCTTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714535.1-403s21c1
Sequence:CCGGTGGACGCAGATACCTGCTTTCCTCGAGGAAAGCAGGTATCTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks