EMAIL THIS PAGE TO A FRIEND

ZNF816

zinc finger protein 816

Synonyms: ZNF816A
Species: Human ZNF816(125893)
UniProtKB ID: Q0VGE8, A8K7H5, Q3KR39, Q659B3
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109571 MISSION® esiRNA esiRNA human ZNF816A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031665 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017125 predicted 1672
2 SASI_Hs01_00017126 predicted 1958
3 SASI_Hs01_00017127 predicted 1934
4 SASI_Hs01_00017129 predicted 2222
5 SASI_Hs01_00017130 predicted 842
6 SASI_Hs01_00017124 predicted 953
7 SASI_Hs01_00017131 predicted 1089
8 SASI_Hs01_00017132 predicted 933
9 SASI_Hs01_00017128 predicted 2291
10 SASI_Hs02_00307663 predicted 1102
11 SASI_Hs01_00017133 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031665
ZNF816 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 816
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-1870s1c1
Sequence:CCGGCCTTGAAAGACATAGGAGAATCTCGAGATTCTCCTATGTCTTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-831s1c1
Sequence:CCGGGTAACCAATTGGACAAGTCTACTCGAGTAGACTTGTCCAATTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-1437s1c1
Sequence:CCGGGTCAGAAATCATCCCTTCAATCTCGAGATTGAAGGGATGATTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031665.1-2514s1c1
Sequence:CCGGGCAAAGCCTTTACTTCATGTTCTCGAGAACATGAAGTAAAGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031665.1-2539s1c1
Sequence:CCGGCCTCATTAGACATCAGAGAATCTCGAGATTCTCTGATGTCTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031665
ZNF816 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 816
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-1870s1c1
Sequence:CCGGCCTTGAAAGACATAGGAGAATCTCGAGATTCTCCTATGTCTTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-831s1c1
Sequence:CCGGGTAACCAATTGGACAAGTCTACTCGAGTAGACTTGTCCAATTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-1437s1c1
Sequence:CCGGGTCAGAAATCATCCCTTCAATCTCGAGATTGAAGGGATGATTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031665.1-2514s1c1
Sequence:CCGGGCAAAGCCTTTACTTCATGTTCTCGAGAACATGAAGTAAAGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031665.1-2539s1c1
Sequence:CCGGCCTCATTAGACATCAGAGAATCTCGAGATTCTCTGATGTCTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031665
ZNF816 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 816
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-1870s1c1
Sequence:CCGGCCTTGAAAGACATAGGAGAATCTCGAGATTCTCCTATGTCTTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-831s1c1
Sequence:CCGGGTAACCAATTGGACAAGTCTACTCGAGTAGACTTGTCCAATTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031665.1-1437s1c1
Sequence:CCGGGTCAGAAATCATCCCTTCAATCTCGAGATTGAAGGGATGATTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031665.1-2514s1c1
Sequence:CCGGGCAAAGCCTTTACTTCATGTTCTCGAGAACATGAAGTAAAGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031665.1-2539s1c1
Sequence:CCGGCCTCATTAGACATCAGAGAATCTCGAGATTCTCTGATGTCTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks