EMAIL THIS PAGE TO A FRIEND

ZNF818P

zinc finger protein 818, pseudogene

Synonyms: ZNF818
Species: Human ZNF818P(390963)
UniProtKB ID: Q6ZRF7
Gene ID:
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001675 Rosetta Predictions human pricing
XR_040818 Rosetta Predictions human pricing
XR_040819 Rosetta Predictions human pricing
XR_040820 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157591 predicted 437
2 SASI_Hs01_00157592 predicted 364
3 SASI_Hs01_00157593 predicted 423
4 SASI_Hs01_00157594 predicted 415
5 SASI_Hs01_00157595 predicted 476
6 SASI_Hs01_00157596 predicted 109
7 SASI_Hs01_00157597 predicted 525
8 SASI_Hs01_00157598 predicted 325
9 SASI_Hs01_00157599 predicted 694
10 SASI_Hs01_00157600 predicted 80
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522200 predicted 2087
2 SASI_Hs02_00522201 predicted 2070
3 SASI_Hs02_00522202 predicted 1466
4 SASI_Hs02_00522203 predicted 608
5 SASI_Hs02_00522204 predicted 314
6 SASI_Hs02_00522205 predicted 954
7 SASI_Hs02_00522206 predicted 725
8 SASI_Hs02_00522207 predicted 1068
9 SASI_Hs02_00522208 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522209 predicted 2083
2 SASI_Hs02_00522210 predicted 2075
3 SASI_Hs02_00522211 predicted 1131
4 SASI_Hs02_00522212 predicted 604
5 SASI_Hs02_00522213 predicted 307
6 SASI_Hs02_00522214 predicted 957
7 SASI_Hs02_00522215 predicted 726
8 SASI_Hs02_00522216 predicted 1070
9 SASI_Hs02_00522217 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522218 predicted 2086
2 SASI_Hs02_00522219 predicted 2074
3 SASI_Hs02_00522220 predicted 1464
4 SASI_Hs02_00522221 predicted 613
5 SASI_Hs02_00522222 predicted 312
6 SASI_Hs02_00522223 predicted 957
7 SASI_Hs02_00522224 predicted 725
8 SASI_Hs02_00522225 predicted 1070
9 SASI_Hs02_00522226 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372745
ZNF818P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 818, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_372745.2-3512s1c1
Sequence:CCGGGCAGAATAATTCCAGGCCAAACTCGAGTTTGGCCTGGAATTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-168s1c1
Sequence:CCGGCAGAGAAATACCTGCAATTAACTCGAGTTAATTGCAGGTATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-1702s1c1
Sequence:CCGGCTTAGACATCATGAGAGTATTCTCGAGAATACTCTCATGATGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-235s1c1
Sequence:CCGGGCAGGAAATAAGCCAGTTGAACTCGAGTTCAACTGGCTTATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-365s1c1
Sequence:CCGGCCTCAGTTTCATTACTTCAAACTCGAGTTTGAAGTAATGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372745
ZNF818P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 818, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_372745.2-3512s1c1
Sequence:CCGGGCAGAATAATTCCAGGCCAAACTCGAGTTTGGCCTGGAATTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-168s1c1
Sequence:CCGGCAGAGAAATACCTGCAATTAACTCGAGTTAATTGCAGGTATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-1702s1c1
Sequence:CCGGCTTAGACATCATGAGAGTATTCTCGAGAATACTCTCATGATGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-235s1c1
Sequence:CCGGGCAGGAAATAAGCCAGTTGAACTCGAGTTCAACTGGCTTATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-365s1c1
Sequence:CCGGCCTCAGTTTCATTACTTCAAACTCGAGTTTGAAGTAATGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372745
ZNF818P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 818, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_372745.2-3512s1c1
Sequence:CCGGGCAGAATAATTCCAGGCCAAACTCGAGTTTGGCCTGGAATTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-168s1c1
Sequence:CCGGCAGAGAAATACCTGCAATTAACTCGAGTTAATTGCAGGTATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-1702s1c1
Sequence:CCGGCTTAGACATCATGAGAGTATTCTCGAGAATACTCTCATGATGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-235s1c1
Sequence:CCGGGCAGGAAATAAGCCAGTTGAACTCGAGTTCAACTGGCTTATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372745.2-365s1c1
Sequence:CCGGCCTCAGTTTCATTACTTCAAACTCGAGTTTGAAGTAATGAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks