EMAIL THIS PAGE TO A FRIEND

ZNF81

zinc finger protein 81

Synonyms: HFZ20 MRX45 dJ54B20.6
UniProtKB ID: P51508, Q6RX22, Q96QH6
Gene ID:
Human(347344) Summary: This gene encodes a protein that likely functions as a transcription factor. The protein contains an N-terminal KRAB domain and several C2H2-type zinc finger motifs. Mutations in this gene cause mental retardation X-linked type 45 (MRX45). [provided by RefSeq, May 2010]
Horse(100061439) zinc finger protein 81
dog(491863) zinc finger protein 81
domestic cat(101090593) zinc finger protein 81
cow(100141016) zinc finger protein 81
sheep(101114848) zinc finger protein 81
domestic guinea pig(101789187) zinc finger protein 81
naked mole-rat(101696784) zinc finger protein 81
Domestic Rabbit(100353207) zinc finger protein 81
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_293284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293284 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028181 MISSION® esiRNA esiRNA human ZNF81 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007137 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343024 predicted 1079
2 SASI_Hs02_00343025 predicted 1311
3 SASI_Hs02_00343026 predicted 2026
4 SASI_Hs02_00343027 predicted 2430
5 SASI_Hs02_00343028 predicted 1794
6 SASI_Hs02_00343029 predicted 1687
7 SASI_Hs02_00343030 predicted 2157
8 SASI_Hs02_00343031 predicted 888
9 SASI_Hs02_00343032 predicted 1930
10 SASI_Hs02_00343033 predicted 722
11 SASI_Hs01_00075364 predicted 418
12 SASI_Hs01_00075365 predicted 413
13 SASI_Hs01_00075366 predicted 409
14 SASI_Hs01_00075367 predicted 474
15 SASI_Hs01_00075368 predicted 479
16 SASI_Hs01_00075369 predicted 469
17 SASI_Hs01_00075370 predicted 414
18 SASI_Hs01_00075371 predicted 552
19 SASI_Hs01_00075372 predicted 447
20 SASI_Hs01_00075373 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293284
ZNF81 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 81
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-1204s1c1
Sequence:CCGGGCCCTCAATATACATCAGAAACTCGAGTTTCTGATGTATATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-459s1c1
Sequence:CCGGTCGCACTACTTTCCTCAATAACTCGAGTTATTGAGGAAAGTAGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-967s1c1
Sequence:CCGGCTGAGAGTTCATAGAGATGAACTCGAGTTCATCTCTATGAACTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-643s1c1
Sequence:CCGGGCAGCAAAGAACCTGGATAAACTCGAGTTTATCCAGGTTCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-1194s1c1
Sequence:CCGGCCTGAACTCAGCCCTCAATATCTCGAGATATTGAGGGCTGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293284
ZNF81 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 81
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-1204s1c1
Sequence:CCGGGCCCTCAATATACATCAGAAACTCGAGTTTCTGATGTATATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-459s1c1
Sequence:CCGGTCGCACTACTTTCCTCAATAACTCGAGTTATTGAGGAAAGTAGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-967s1c1
Sequence:CCGGCTGAGAGTTCATAGAGATGAACTCGAGTTCATCTCTATGAACTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-643s1c1
Sequence:CCGGGCAGCAAAGAACCTGGATAAACTCGAGTTTATCCAGGTTCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-1194s1c1
Sequence:CCGGCCTGAACTCAGCCCTCAATATCTCGAGATATTGAGGGCTGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293284
ZNF81 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 81
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-1204s1c1
Sequence:CCGGGCCCTCAATATACATCAGAAACTCGAGTTTCTGATGTATATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-459s1c1
Sequence:CCGGTCGCACTACTTTCCTCAATAACTCGAGTTATTGAGGAAAGTAGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-967s1c1
Sequence:CCGGCTGAGAGTTCATAGAGATGAACTCGAGTTCATCTCTATGAACTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-643s1c1
Sequence:CCGGGCAGCAAAGAACCTGGATAAACTCGAGTTTATCCAGGTTCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293284.4-1194s1c1
Sequence:CCGGCCTGAACTCAGCCCTCAATATCTCGAGATATTGAGGGCTGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks