EMAIL THIS PAGE TO A FRIEND

ZNF821

zinc finger protein 821

UniProtKB ID: O75541, A6NK48, B4DKK4, D3DWS3
Gene ID:
Human(55565) Summary: This gene encodes a protein with two C2H2 zinc finger motifs and a score-and-three (23)-amino acid peptide repeat (STPR) domain. The STPR domain of the encoded protein binds to double stranded DNA and may also contain a nuclear localization signal, suggesting that this protein interacts with chromosomal DNA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
chicken(415878) zinc finger protein 821
dog(489726) zinc finger protein 821
domestic cat(101100856) zinc finger protein 821
cow(532668) zinc finger protein 821
sheep(101103172) zinc finger protein 821
naked mole-rat(101702493) zinc finger protein 821
domestic guinea pig(100731573) zinc finger protein 821
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017530 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039081 MISSION® esiRNA esiRNA human ZNF821 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017530 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037539 predicted 561
2 SASI_Hs01_00037540 predicted 1016
3 SASI_Hs01_00037541 predicted 530
4 SASI_Hs01_00037543 predicted 799
5 SASI_Hs01_00037545 predicted 943
6 SASI_Hs02_00350152 predicted 841
7 SASI_Hs02_00350153 predicted 834
8 SASI_Hs01_00037547 predicted 910
9 SASI_Hs02_00350154 predicted 1232
10 SASI_Hs01_00037548 predicted 739
11 SASI_Hs01_00037542 predicted 456
12 SASI_Hs01_00037544 predicted 443
13 SASI_Hs01_00037546 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017530
ZNF821 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 821
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-494s1c1
Sequence:CCGGGTCAAAGTGGAGAAAGAGTTACTCGAGTAACTCTTTCTCCACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-836s1c1
Sequence:CCGGGAGAAACTTCCTGAAGTACTACTCGAGTAGTACTTCAGGAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-643s1c1
Sequence:CCGGGCAGTTGATTGCTCACGTGTACTCGAGTACACGTGAGCAATCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017530.1-1627s21c1
Sequence:CCGGACCTGAGCAGCCCTTGCATATCTCGAGATATGCAAGGGCTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-1031s21c1
Sequence:CCGGCGTCGACAGAATGAGCCTTTGCTCGAGCAAAGGCTCATTCTGTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-556s21c1
Sequence:CCGGGCACGAGGTCACAGGGAATTTCTCGAGAAATTCCCTGTGACCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017530.1-1598s1c1
Sequence:CCGGAGAGGCAGGCCTGGGTTTATTCTCGAGAATAAACCCAGGCCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-743s1c1
Sequence:CCGGTTGGGTCGCCACCTCTTAATCCTCGAGGATTAAGAGGTGGCGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-1332s21c1
Sequence:CCGGTGATGTTGCGAGCTCAGTTTGCTCGAGCAAACTGAGCTCGCAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-969s21c1
Sequence:CCGGACTGTGCTGCCTACCGTAAACCTCGAGGTTTACGGTAGGCAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017530
ZNF821 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 821
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-494s1c1
Sequence:CCGGGTCAAAGTGGAGAAAGAGTTACTCGAGTAACTCTTTCTCCACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-836s1c1
Sequence:CCGGGAGAAACTTCCTGAAGTACTACTCGAGTAGTACTTCAGGAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-643s1c1
Sequence:CCGGGCAGTTGATTGCTCACGTGTACTCGAGTACACGTGAGCAATCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017530.1-1627s21c1
Sequence:CCGGACCTGAGCAGCCCTTGCATATCTCGAGATATGCAAGGGCTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-1031s21c1
Sequence:CCGGCGTCGACAGAATGAGCCTTTGCTCGAGCAAAGGCTCATTCTGTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-556s21c1
Sequence:CCGGGCACGAGGTCACAGGGAATTTCTCGAGAAATTCCCTGTGACCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017530.1-1598s1c1
Sequence:CCGGAGAGGCAGGCCTGGGTTTATTCTCGAGAATAAACCCAGGCCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-743s1c1
Sequence:CCGGTTGGGTCGCCACCTCTTAATCCTCGAGGATTAAGAGGTGGCGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-1332s21c1
Sequence:CCGGTGATGTTGCGAGCTCAGTTTGCTCGAGCAAACTGAGCTCGCAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-969s21c1
Sequence:CCGGACTGTGCTGCCTACCGTAAACCTCGAGGTTTACGGTAGGCAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017530
ZNF821 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 821
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-494s1c1
Sequence:CCGGGTCAAAGTGGAGAAAGAGTTACTCGAGTAACTCTTTCTCCACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-836s1c1
Sequence:CCGGGAGAAACTTCCTGAAGTACTACTCGAGTAGTACTTCAGGAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-643s1c1
Sequence:CCGGGCAGTTGATTGCTCACGTGTACTCGAGTACACGTGAGCAATCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017530.1-1627s21c1
Sequence:CCGGACCTGAGCAGCCCTTGCATATCTCGAGATATGCAAGGGCTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-1031s21c1
Sequence:CCGGCGTCGACAGAATGAGCCTTTGCTCGAGCAAAGGCTCATTCTGTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-556s21c1
Sequence:CCGGGCACGAGGTCACAGGGAATTTCTCGAGAAATTCCCTGTGACCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017530.1-1598s1c1
Sequence:CCGGAGAGGCAGGCCTGGGTTTATTCTCGAGAATAAACCCAGGCCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017530.1-743s1c1
Sequence:CCGGTTGGGTCGCCACCTCTTAATCCTCGAGGATTAAGAGGTGGCGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-1332s21c1
Sequence:CCGGTGATGTTGCGAGCTCAGTTTGCTCGAGCAAACTGAGCTCGCAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017530.1-969s21c1
Sequence:CCGGACTGTGCTGCCTACCGTAAACCTCGAGGTTTACGGTAGGCAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks