EMAIL THIS PAGE TO A FRIEND

ZNF823

zinc finger protein 823

Synonyms: HSZFP36
Species: Human ZNF823(55552)
UniProtKB ID: P16415, A0PJL4, Q6P4A9
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080493 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108401 MISSION® esiRNA esiRNA human ZNF823 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080493 Rosetta Predictions human pricing
XM_375568 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315375 predicted 1650
2 SASI_Hs02_00315376 predicted 597
3 SASI_Hs02_00315377 predicted 981
4 SASI_Hs02_00315378 predicted 980
5 SASI_Hs02_00315379 predicted 269
6 SASI_Hs02_00315380 predicted 614
7 SASI_Hs02_00315381 predicted 1154
8 SASI_Hs02_00315382 predicted 428
9 SASI_Hs02_00315383 predicted 896
10 SASI_Hs02_00315384 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248710 predicted 790
2 SASI_Hs01_00248711 predicted 1178
3 SASI_Hs01_00248712 predicted 1164
4 SASI_Hs01_00248713 predicted 457
5 SASI_Hs01_00248714 predicted 801
6 SASI_Hs01_00248715 predicted 1341
7 SASI_Hs01_00248716 predicted 619
8 SASI_Hs01_00248717 predicted 1086
9 SASI_Hs01_00248718 predicted 1668
10 SASI_Hs01_00248719 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080493
VALIDATED
ZNF823 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 823
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080493.2-1154s21c1
Sequence:CCGGGTCCTAGTTCAGTTCGAAATCCTCGAGGATTTCGAACTGAACTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080493.2-976s21c1
Sequence:CCGGGCCTTCAGCTGTTACTATTACCTCGAGGTAATAGTAACAGCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080493.2-2115s21c1
Sequence:CCGGTGGTTCCAGCACCCTCTAAATCTCGAGATTTAGAGGGTGCTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080493.2-732s21c1
Sequence:CCGGTTGGCCCAGTTTATTTCATTTCTCGAGAAATGAAATAAACTGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080493.2-447s21c1
Sequence:CCGGCTTGGGTCATTCGTCTCTTAACTCGAGTTAAGAGACGAATGACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080493
VALIDATED
ZNF823 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 823
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080493.2-1154s21c1
Sequence:CCGGGTCCTAGTTCAGTTCGAAATCCTCGAGGATTTCGAACTGAACTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080493.2-976s21c1
Sequence:CCGGGCCTTCAGCTGTTACTATTACCTCGAGGTAATAGTAACAGCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080493.2-2115s21c1
Sequence:CCGGTGGTTCCAGCACCCTCTAAATCTCGAGATTTAGAGGGTGCTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080493.2-732s21c1
Sequence:CCGGTTGGCCCAGTTTATTTCATTTCTCGAGAAATGAAATAAACTGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080493.2-447s21c1
Sequence:CCGGCTTGGGTCATTCGTCTCTTAACTCGAGTTAAGAGACGAATGACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080493
VALIDATED
ZNF823 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 823
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080493.2-1154s21c1
Sequence:CCGGGTCCTAGTTCAGTTCGAAATCCTCGAGGATTTCGAACTGAACTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080493.2-976s21c1
Sequence:CCGGGCCTTCAGCTGTTACTATTACCTCGAGGTAATAGTAACAGCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080493.2-2115s21c1
Sequence:CCGGTGGTTCCAGCACCCTCTAAATCTCGAGATTTAGAGGGTGCTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080493.2-732s21c1
Sequence:CCGGTTGGCCCAGTTTATTTCATTTCTCGAGAAATGAAATAAACTGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080493.2-447s21c1
Sequence:CCGGCTTGGGTCATTCGTCTCTTAACTCGAGTTAAGAGACGAATGACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks