EMAIL THIS PAGE TO A FRIEND

ZNF826P

zinc finger protein 826, pseudogene

Synonyms: ZNF826
Species: Human ZNF826P(664701)
UniProtKB ID: Q6ZT77
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039884 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039884 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140728 predicted 1695
2 SASI_Hs02_00308696 predicted 1573
3 SASI_Hs01_00140730 predicted 1465
4 SASI_Hs01_00140731 predicted 1901
5 SASI_Hs01_00140732 predicted 1819
6 SASI_Hs01_00140733 predicted 1821
7 SASI_Hs01_00140726 predicted 1638
8 SASI_Hs01_00140727 predicted 1703
9 SASI_Hs01_00140729 predicted 1577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039884
ZNF826P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 826, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1939s21c1
Sequence:CCGGTGGACAGAAACCAATACTGTACTCGAGTACAGTATTGGTTTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1821s21c1
Sequence:CCGGCCTCAACTCTAAGTGAATATACTCGAGTATATTCACTTAGAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039884.2-3599s21c1
Sequence:CCGGATTGGTATTTGTGGGTATATACTCGAGTATATACCCACAAATACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1950s21c1
Sequence:CCGGCAATACTGTAACAAAGCTTTACTCGAGTAAAGCTTTGTTACAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1472s21c1
Sequence:CCGGATGGCAAAGCTTTCACCCATTCTCGAGAATGGGTGAAAGCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039884
ZNF826P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 826, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1939s21c1
Sequence:CCGGTGGACAGAAACCAATACTGTACTCGAGTACAGTATTGGTTTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1821s21c1
Sequence:CCGGCCTCAACTCTAAGTGAATATACTCGAGTATATTCACTTAGAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039884.2-3599s21c1
Sequence:CCGGATTGGTATTTGTGGGTATATACTCGAGTATATACCCACAAATACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1950s21c1
Sequence:CCGGCAATACTGTAACAAAGCTTTACTCGAGTAAAGCTTTGTTACAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1472s21c1
Sequence:CCGGATGGCAAAGCTTTCACCCATTCTCGAGAATGGGTGAAAGCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039884
ZNF826P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 826, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1939s21c1
Sequence:CCGGTGGACAGAAACCAATACTGTACTCGAGTACAGTATTGGTTTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1821s21c1
Sequence:CCGGCCTCAACTCTAAGTGAATATACTCGAGTATATTCACTTAGAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039884.2-3599s21c1
Sequence:CCGGATTGGTATTTGTGGGTATATACTCGAGTATATACCCACAAATACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1950s21c1
Sequence:CCGGCAATACTGTAACAAAGCTTTACTCGAGTAAAGCTTTGTTACAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039884.2-1472s21c1
Sequence:CCGGATGGCAAAGCTTTCACCCATTCTCGAGAATGGGTGAAAGCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks