EMAIL THIS PAGE TO A FRIEND

ZNF827

zinc finger protein 827

UniProtKB ID: Q17R98, B7ZL52, Q7Z4S7, Q8N279
Gene ID:
Zebrafish(565077) zinc finger protein 827
dog(610376) zinc finger protein 827
Horse(100070873) zinc finger protein 827
domestic cat(101085201) zinc finger protein 827
chicken(422465) zinc finger protein 827
domestic guinea pig(100732508) zinc finger protein 827
naked mole-rat(101697103) zinc finger protein 827
cow(535359) zinc finger protein 827
sheep(101109647) zinc finger protein 827
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178835 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035771 MISSION® esiRNA esiRNA human ZNF827 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178835 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092077 predicted 1964
2 SASI_Hs01_00092078 predicted 2611
3 SASI_Hs01_00092079 predicted 2673
4 SASI_Hs01_00092081 predicted 2778
5 SASI_Hs02_00369884 predicted 2990
6 SASI_Hs01_00092082 predicted 623
7 SASI_Hs02_00369885 predicted 2737
8 SASI_Hs01_00092085 predicted 1881
9 SASI_Hs02_00369886 predicted 2207
10 SASI_Hs01_00092086 predicted 3140
11 SASI_Hs01_00092080 predicted 1727
12 SASI_Hs01_00092083 predicted 2324
13 SASI_Hs01_00092084 predicted 2583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178835
VALIDATED
ZNF827 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 827
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-707s21c1
Sequence:CCGGATGCCGTTCTGCAGGACAAATCTCGAGATTTGTCCTGCAGAACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1283s21c1
Sequence:CCGGCTCGCAAGGACAATCTCAAATCTCGAGATTTGAGATTGTCCTTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1227s21c1
Sequence:CCGGGGTGATTCACACAGGTTTAAACTCGAGTTTAAACCTGTGTGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-3318s21c1
Sequence:CCGGTAGGTGCCCATTCTGCATTTACTCGAGTAAATGCAGAATGGGCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1758s21c1
Sequence:GTACCGGTGTTAAGATGGCGTCTGATTTCTCGAGAAATCAGACGCCATCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-2389s1c1
Sequence:CCGGGAAGAATATCAGCTCCAGAAACTCGAGTTTCTGGAGCTGATATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_178835.2-1093s1c1
Sequence:CCGGGAGTTTCTAAACCCTCCAATTCTCGAGAATTGGAGGGTTTAGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-551s1c1
Sequence:CCGGGCAGGAACAGAATGACCAATACTCGAGTATTGGTCATTCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-724s1c1
Sequence:CCGGCCATGCGATTTGAGTCCCTTTCTCGAGAAAGGGACTCAAATCGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140808    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178835.2-3647s1c1
Sequence:CCGGGTTCAAGACCACACACCCTTTCTCGAGAAAGGGTGTGTGGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178835.2-3209s1c1
Sequence:CCGGGCTGGAGCATAAGAAATGCCACTCGAGTGGCATTTCTTATGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-3095s1c1
Sequence:CCGGCAACTTTGTCTGCAAGACGAACTCGAGTTCGTCTTGCAGACAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178835
VALIDATED
ZNF827 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 827
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-707s21c1
Sequence:CCGGATGCCGTTCTGCAGGACAAATCTCGAGATTTGTCCTGCAGAACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1283s21c1
Sequence:CCGGCTCGCAAGGACAATCTCAAATCTCGAGATTTGAGATTGTCCTTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1227s21c1
Sequence:CCGGGGTGATTCACACAGGTTTAAACTCGAGTTTAAACCTGTGTGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-3318s21c1
Sequence:CCGGTAGGTGCCCATTCTGCATTTACTCGAGTAAATGCAGAATGGGCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1758s21c1
Sequence:GTACCGGTGTTAAGATGGCGTCTGATTTCTCGAGAAATCAGACGCCATCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-2389s1c1
Sequence:CCGGGAAGAATATCAGCTCCAGAAACTCGAGTTTCTGGAGCTGATATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_178835.2-1093s1c1
Sequence:CCGGGAGTTTCTAAACCCTCCAATTCTCGAGAATTGGAGGGTTTAGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-551s1c1
Sequence:CCGGGCAGGAACAGAATGACCAATACTCGAGTATTGGTCATTCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-724s1c1
Sequence:CCGGCCATGCGATTTGAGTCCCTTTCTCGAGAAAGGGACTCAAATCGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140808    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178835.2-3647s1c1
Sequence:CCGGGTTCAAGACCACACACCCTTTCTCGAGAAAGGGTGTGTGGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178835.2-3209s1c1
Sequence:CCGGGCTGGAGCATAAGAAATGCCACTCGAGTGGCATTTCTTATGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-3095s1c1
Sequence:CCGGCAACTTTGTCTGCAAGACGAACTCGAGTTCGTCTTGCAGACAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178835
VALIDATED
ZNF827 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 827
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-707s21c1
Sequence:CCGGATGCCGTTCTGCAGGACAAATCTCGAGATTTGTCCTGCAGAACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1283s21c1
Sequence:CCGGCTCGCAAGGACAATCTCAAATCTCGAGATTTGAGATTGTCCTTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1227s21c1
Sequence:CCGGGGTGATTCACACAGGTTTAAACTCGAGTTTAAACCTGTGTGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-3318s21c1
Sequence:CCGGTAGGTGCCCATTCTGCATTTACTCGAGTAAATGCAGAATGGGCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_178835.3-1758s21c1
Sequence:GTACCGGTGTTAAGATGGCGTCTGATTTCTCGAGAAATCAGACGCCATCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-2389s1c1
Sequence:CCGGGAAGAATATCAGCTCCAGAAACTCGAGTTTCTGGAGCTGATATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_178835.2-1093s1c1
Sequence:CCGGGAGTTTCTAAACCCTCCAATTCTCGAGAATTGGAGGGTTTAGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-551s1c1
Sequence:CCGGGCAGGAACAGAATGACCAATACTCGAGTATTGGTCATTCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-724s1c1
Sequence:CCGGCCATGCGATTTGAGTCCCTTTCTCGAGAAAGGGACTCAAATCGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140808    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178835.2-3647s1c1
Sequence:CCGGGTTCAAGACCACACACCCTTTCTCGAGAAAGGGTGTGTGGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178835.2-3209s1c1
Sequence:CCGGGCTGGAGCATAAGAAATGCCACTCGAGTGGCATTTCTTATGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178835.2-3095s1c1
Sequence:CCGGCAACTTTGTCTGCAAGACGAACTCGAGTTCGTCTTGCAGACAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks