EMAIL THIS PAGE TO A FRIEND

ZNF829

zinc finger protein 829

UniProtKB ID: Q3KNS6, Q3KNS7, Q6ZNN0, Q7Z657
Gene ID:
Horse(100061841) zinc finger protein 829
dog(100683446) zinc finger protein 829
naked mole-rat(101716778) zinc finger protein 829
cow(790881) zinc finger protein 829
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037232 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089761 MISSION® esiRNA esiRNA human ZNF829 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037232 Rosetta Predictions human pricing
XM_928511 Rosetta Predictions human pricing
XM_932926 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308241 predicted 724
2 SASI_Hs01_00015545 predicted 1350
3 SASI_Hs02_00308242 predicted 906
4 SASI_Hs02_00308243 predicted 904
5 SASI_Hs02_00308244 predicted 370
6 SASI_Hs02_00308245 predicted 436
7 SASI_Hs02_00308246 predicted 657
8 SASI_Hs02_00308247 predicted 843
9 SASI_Hs02_00308248 predicted 654
10 SASI_Hs01_00015546 predicted 953
11 SASI_Hs01_00015547 predicted 1002
12 SASI_Hs01_00015548 predicted 858
13 SASI_Hs01_00015549 predicted 995
14 SASI_Hs01_00015550 predicted 1272
15 SASI_Hs01_00015551 predicted 1240
16 SASI_Hs01_00015552 predicted 1619
17 SASI_Hs01_00015553 predicted 1540
18 SASI_Hs01_00015554 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253734 predicted 1241
2 SASI_Hs01_00253735 predicted 260
3 SASI_Hs01_00253736 predicted 321
4 SASI_Hs01_00253737 predicted 544
5 SASI_Hs01_00253738 predicted 551
6 SASI_Hs01_00253739 predicted 1273
7 SASI_Hs01_00253740 predicted 1241
8 SASI_Hs01_00253741 predicted 310
9 SASI_Hs01_00253742 predicted 794
10 SASI_Hs01_00253743 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292663 predicted 426
2 SASI_Hs01_00292664 predicted 374
3 SASI_Hs01_00292665 predicted 439
4 SASI_Hs01_00292666 predicted 418
5 SASI_Hs01_00292667 predicted 427
6 SASI_Hs01_00292668 predicted 457
7 SASI_Hs01_00292669 predicted 425
8 SASI_Hs01_00292670 predicted 392
9 SASI_Hs01_00292671 predicted 397
10 SASI_Hs01_00292672 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037232
ZNF829 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 829
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1162s1c1
Sequence:CCGGCTTTACTCAACACTCAAGGCTCTCGAGAGCCTTGAGTGTTGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1358s1c1
Sequence:CCGGCATCAGAGAATCCATACAGATCTCGAGATCTGTATGGATTCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037232.1-881s1c1
Sequence:CCGGCCCTATGAATGTAAGGAATGTCTCGAGACATTCCTTACATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1328s1c1
Sequence:CCGGGCCTTTATTCAGAGCTCAGAACTCGAGTTCTGAGCTCTGAATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1122s1c1
Sequence:CCGGCTGGTGAGAAACCTTATGAATCTCGAGATTCATAAGGTTTCTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1479s1c1
Sequence:CCGGGTAAGGAATGTGGAAAGGCTTCTCGAGAAGCCTTTCCACATTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037232.3-1775s21c1
Sequence:CCGGTTAAACGATACGATAACAAAGCTCGAGCTTTGTTATCGTATCGTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037232.3-521s21c1
Sequence:CCGGGGACGCTGATCAGATGAATTTCTCGAGAAATTCATCTGATCAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037232
ZNF829 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 829
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1162s1c1
Sequence:CCGGCTTTACTCAACACTCAAGGCTCTCGAGAGCCTTGAGTGTTGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1358s1c1
Sequence:CCGGCATCAGAGAATCCATACAGATCTCGAGATCTGTATGGATTCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037232.1-881s1c1
Sequence:CCGGCCCTATGAATGTAAGGAATGTCTCGAGACATTCCTTACATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1328s1c1
Sequence:CCGGGCCTTTATTCAGAGCTCAGAACTCGAGTTCTGAGCTCTGAATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1122s1c1
Sequence:CCGGCTGGTGAGAAACCTTATGAATCTCGAGATTCATAAGGTTTCTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1479s1c1
Sequence:CCGGGTAAGGAATGTGGAAAGGCTTCTCGAGAAGCCTTTCCACATTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037232.3-1775s21c1
Sequence:CCGGTTAAACGATACGATAACAAAGCTCGAGCTTTGTTATCGTATCGTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037232.3-521s21c1
Sequence:CCGGGGACGCTGATCAGATGAATTTCTCGAGAAATTCATCTGATCAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037232
ZNF829 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 829
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1162s1c1
Sequence:CCGGCTTTACTCAACACTCAAGGCTCTCGAGAGCCTTGAGTGTTGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1358s1c1
Sequence:CCGGCATCAGAGAATCCATACAGATCTCGAGATCTGTATGGATTCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037232.1-881s1c1
Sequence:CCGGCCCTATGAATGTAAGGAATGTCTCGAGACATTCCTTACATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1328s1c1
Sequence:CCGGGCCTTTATTCAGAGCTCAGAACTCGAGTTCTGAGCTCTGAATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1122s1c1
Sequence:CCGGCTGGTGAGAAACCTTATGAATCTCGAGATTCATAAGGTTTCTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037232.1-1479s1c1
Sequence:CCGGGTAAGGAATGTGGAAAGGCTTCTCGAGAAGCCTTTCCACATTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037232.3-1775s21c1
Sequence:CCGGTTAAACGATACGATAACAAAGCTCGAGCTTTGTTATCGTATCGTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037232.3-521s21c1
Sequence:CCGGGGACGCTGATCAGATGAATTTCTCGAGAAATTCATCTGATCAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks