EMAIL THIS PAGE TO A FRIEND

ZNF830

zinc finger protein 830

Synonyms: CCDC16 OMCG1 SEL13
UniProtKB ID: Q96NB3, Q96F60, Q96GZ5, Q9BU38
Gene ID:
chicken(420966) zinc finger protein 830
domestic cat(101097684) zinc finger protein 830
dog(480608) zinc finger protein 830
cow(539497) zinc finger protein 830
sheep(101118710) zinc finger protein 830
naked mole-rat(101699572) zinc finger protein 830
domestic guinea pig(100715797) zinc finger protein 830
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052857 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101601 MISSION® esiRNA esiRNA human ZNF830 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052857 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204098 predicted 846
2 SASI_Hs01_00204099 predicted 757
3 SASI_Hs01_00204100 predicted 1227
4 SASI_Hs01_00204101 predicted 1210
5 SASI_Hs01_00204102 predicted 974
6 SASI_Hs01_00204104 predicted 254
7 SASI_Hs02_00361551 predicted 1285
8 SASI_Hs01_00204105 predicted 814
9 SASI_Hs01_00204106 predicted 1212
10 SASI_Hs01_00204107 predicted 1295
11 SASI_Hs01_00204103 predicted 1090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052857
VALIDATED
ZNF830 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 830
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-609s1c1
Sequence:CCGGCTTTAGTACTAATCCTCCCAACTCGAGTTGGGAGGATTAGTACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-87s1c1
Sequence:CCGGGAAACGGATAGAATCTCCATTCTCGAGAATGGAGATTCTATCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052857.1-1021s1c1
Sequence:CCGGGAGAATGCTGACAGCGATGATCTCGAGATCATCGCTGTCAGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-144s1c1
Sequence:CCGGCCTGTGTAACACTCCGGTTAACTCGAGTTAACCGGAGTGTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-803s21c1
Sequence:CCGGGTAGATGCAAGAGTACGAAAGCTCGAGCTTTCGTACTCTTGCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-1000s21c1
Sequence:CCGGACGGAATCGCCAGGATGAAATCTCGAGATTTCATCCTGGCGATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-880s21c1
Sequence:CCGGGAGGCAGGTCAACACTATTTCCTCGAGGAAATAGTGTTGACCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052857
VALIDATED
ZNF830 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 830
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-609s1c1
Sequence:CCGGCTTTAGTACTAATCCTCCCAACTCGAGTTGGGAGGATTAGTACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-87s1c1
Sequence:CCGGGAAACGGATAGAATCTCCATTCTCGAGAATGGAGATTCTATCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052857.1-1021s1c1
Sequence:CCGGGAGAATGCTGACAGCGATGATCTCGAGATCATCGCTGTCAGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-144s1c1
Sequence:CCGGCCTGTGTAACACTCCGGTTAACTCGAGTTAACCGGAGTGTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-803s21c1
Sequence:CCGGGTAGATGCAAGAGTACGAAAGCTCGAGCTTTCGTACTCTTGCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-1000s21c1
Sequence:CCGGACGGAATCGCCAGGATGAAATCTCGAGATTTCATCCTGGCGATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-880s21c1
Sequence:CCGGGAGGCAGGTCAACACTATTTCCTCGAGGAAATAGTGTTGACCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052857
VALIDATED
ZNF830 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 830
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-609s1c1
Sequence:CCGGCTTTAGTACTAATCCTCCCAACTCGAGTTGGGAGGATTAGTACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-87s1c1
Sequence:CCGGGAAACGGATAGAATCTCCATTCTCGAGAATGGAGATTCTATCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_052857.1-1021s1c1
Sequence:CCGGGAGAATGCTGACAGCGATGATCTCGAGATCATCGCTGTCAGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052857.1-144s1c1
Sequence:CCGGCCTGTGTAACACTCCGGTTAACTCGAGTTAACCGGAGTGTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-803s21c1
Sequence:CCGGGTAGATGCAAGAGTACGAAAGCTCGAGCTTTCGTACTCTTGCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-1000s21c1
Sequence:CCGGACGGAATCGCCAGGATGAAATCTCGAGATTTCATCCTGGCGATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052857.3-880s21c1
Sequence:CCGGGAGGCAGGTCAACACTATTTCCTCGAGGAAATAGTGTTGACCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks