EMAIL THIS PAGE TO A FRIEND

ZNF831

zinc finger protein 831

Synonyms: C20orf174 dJ492J12.1
UniProtKB ID: Q5JPB2, Q5TDR4, Q8TCP0
Gene ID:
domestic guinea pig(101789288) zinc finger protein 831
naked mole-rat(101721906) zinc finger protein 831
Domestic Rabbit(100348356) zinc finger protein 831
Zebrafish(100189616) zinc finger protein 831
Horse(100050831) zinc finger protein 831
domestic cat(101087468) zinc finger protein 831
dog(611991) zinc finger protein 831
chicken(419309) zinc finger protein 831
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178457 Rosetta Predictions human pricing
XM_066058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369696 predicted 534
2 SASI_Hs02_00369697 predicted 419
3 SASI_Hs02_00369698 predicted 3877
4 SASI_Hs02_00369699 predicted 4836
5 SASI_Hs02_00369700 predicted 5068
6 SASI_Hs02_00369701 predicted 5039
7 SASI_Hs02_00369702 predicted 3607
8 SASI_Hs02_00369703 predicted 889
9 SASI_Hs02_00369704 predicted 4118
10 SASI_Hs02_00369705 predicted 3727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_066058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292134 predicted 544
2 SASI_Hs01_00292135 predicted 427
3 SASI_Hs01_00292136 predicted 3879
4 SASI_Hs01_00292137 predicted 4850
5 SASI_Hs01_00292138 predicted 5065
6 SASI_Hs01_00292139 predicted 5043
7 SASI_Hs01_00292140 predicted 3613
8 SASI_Hs01_00292141 predicted 4120
9 SASI_Hs01_00292142 predicted 4214
10 SASI_Hs01_00292143 predicted 3733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178457
ZNF831 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 831
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-2917s21c1
Sequence:CCGGCCTGAAGAACGGGCATCATTTCTCGAGAAATGATGCCCGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4999s21c1
Sequence:CCGGAGCGACGATGAAGACCGATTACTCGAGTAATCGGTCTTCATCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4842s21c1
Sequence:GTACCGGACGTCAGGTATCTGGATTAATCTCGAGATTAATCCAGATACCTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178457.1-6566s21c1
Sequence:CCGGCCTGGTTACTTAGCATATATTCTCGAGAATATATGCTAAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4176s21c1
Sequence:CCGGACGAACTGTGAAGGATATTTCCTCGAGGAAATATCCTTCACAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178457
ZNF831 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 831
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-2917s21c1
Sequence:CCGGCCTGAAGAACGGGCATCATTTCTCGAGAAATGATGCCCGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4999s21c1
Sequence:CCGGAGCGACGATGAAGACCGATTACTCGAGTAATCGGTCTTCATCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4842s21c1
Sequence:GTACCGGACGTCAGGTATCTGGATTAATCTCGAGATTAATCCAGATACCTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178457.1-6566s21c1
Sequence:CCGGCCTGGTTACTTAGCATATATTCTCGAGAATATATGCTAAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4176s21c1
Sequence:CCGGACGAACTGTGAAGGATATTTCCTCGAGGAAATATCCTTCACAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178457
ZNF831 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 831
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-2917s21c1
Sequence:CCGGCCTGAAGAACGGGCATCATTTCTCGAGAAATGATGCCCGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4999s21c1
Sequence:CCGGAGCGACGATGAAGACCGATTACTCGAGTAATCGGTCTTCATCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4842s21c1
Sequence:GTACCGGACGTCAGGTATCTGGATTAATCTCGAGATTAATCCAGATACCTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178457.1-6566s21c1
Sequence:CCGGCCTGGTTACTTAGCATATATTCTCGAGAATATATGCTAAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178457.1-4176s21c1
Sequence:CCGGACGAACTGTGAAGGATATTTCCTCGAGGAAATATCCTTCACAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks