EMAIL THIS PAGE TO A FRIEND

ZNF833P

zinc finger protein 833, pseudogene

Synonyms: ZNF833
Species: Human ZNF833P(401898)
UniProtKB ID: Q6ZTB9, B2RPA0
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50380 Anti-LOC401898 antibody produced in rabbit affinity isolated antibody bovine, horse, mouse, rabbit, human, guinea pig, rat
western blot pricing
SAB2103684 Anti-LOC401898, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013691 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044674 predicted 1264
2 SASI_Hs01_00044675 predicted 1090
3 SASI_Hs01_00044676 predicted 666
4 SASI_Hs01_00044677 predicted 883
5 SASI_Hs01_00044679 predicted 1273
6 SASI_Hs01_00044680 predicted 1045
7 SASI_Hs01_00044678 predicted 2346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013691
ZNF833P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 833, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013691.1-2790s1c1
Sequence:CCGGCCATGAAAGAAGTCACATTTACTCGAGTAAATGTGACTTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2090s1c1
Sequence:CCGGAGGCCTTTGATAATCTACATTCTCGAGAATGTAGATTATCAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2398s1c1
Sequence:CCGGCAGGTGTATAAATGTAAGGAACTCGAGTTCCTTACATTTATACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2571s1c1
Sequence:CCGGCTATGAATGCAGAACGTGGAACTCGAGTTCCACGTTCTGCATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2468s1c1
Sequence:CCGGCCCACACTTCACAGAAACTTTCTCGAGAAAGTTTCTGTGAAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013691
ZNF833P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 833, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013691.1-2790s1c1
Sequence:CCGGCCATGAAAGAAGTCACATTTACTCGAGTAAATGTGACTTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2090s1c1
Sequence:CCGGAGGCCTTTGATAATCTACATTCTCGAGAATGTAGATTATCAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2398s1c1
Sequence:CCGGCAGGTGTATAAATGTAAGGAACTCGAGTTCCTTACATTTATACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2571s1c1
Sequence:CCGGCTATGAATGCAGAACGTGGAACTCGAGTTCCACGTTCTGCATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2468s1c1
Sequence:CCGGCCCACACTTCACAGAAACTTTCTCGAGAAAGTTTCTGTGAAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013691
ZNF833P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 833, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013691.1-2790s1c1
Sequence:CCGGCCATGAAAGAAGTCACATTTACTCGAGTAAATGTGACTTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2090s1c1
Sequence:CCGGAGGCCTTTGATAATCTACATTCTCGAGAATGTAGATTATCAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2398s1c1
Sequence:CCGGCAGGTGTATAAATGTAAGGAACTCGAGTTCCTTACATTTATACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2571s1c1
Sequence:CCGGCTATGAATGCAGAACGTGGAACTCGAGTTCCACGTTCTGCATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013691.1-2468s1c1
Sequence:CCGGCCCACACTTCACAGAAACTTTCTCGAGAAAGTTTCTGTGAAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks