EMAIL THIS PAGE TO A FRIEND

ZNF835

zinc finger protein 835

Synonyms: BC37295_3
Species: Human ZNF835(90485)
UniProtKB ID: Q9Y2P0, B7Z5Y0, G3V1S0
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005850 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077728 predicted 229
2 SASI_Hs01_00077729 predicted 1273
3 SASI_Hs01_00077730 predicted 222
4 SASI_Hs01_00077731 predicted 592
5 SASI_Hs01_00077732 predicted 238
6 SASI_Hs01_00077733 predicted 812
7 SASI_Hs01_00077734 predicted 1229
8 SASI_Hs01_00077735 predicted 976
9 SASI_Hs01_00077737 predicted 208
10 SASI_Hs02_00305029 predicted 325
11 SASI_Hs01_00077736 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005850
ZNF835 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 835
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-1275s1c1
Sequence:CCGGCTCGCTTATAGAGCACCAGAACTCGAGTTCTGGTGCTCTATAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-436s1c1
Sequence:CCGGGCGTTCATCTTACACCAGAGACTCGAGTCTCTGGTGTAAGATGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-103s1c1
Sequence:CCGGGAGTTGGAAGGAAACTGGAAACTCGAGTTTCCAGTTTCCTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-420s1c1
Sequence:CCGGCTTCAGCTACTGTTCAGCGTTCTCGAGAACGCTGAACAGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-239s1c1
Sequence:CCGGGCCGAATCCCAAGAACCATATCTCGAGATATGGTTCTTGGGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005850
ZNF835 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 835
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-1275s1c1
Sequence:CCGGCTCGCTTATAGAGCACCAGAACTCGAGTTCTGGTGCTCTATAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-436s1c1
Sequence:CCGGGCGTTCATCTTACACCAGAGACTCGAGTCTCTGGTGTAAGATGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-103s1c1
Sequence:CCGGGAGTTGGAAGGAAACTGGAAACTCGAGTTTCCAGTTTCCTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-420s1c1
Sequence:CCGGCTTCAGCTACTGTTCAGCGTTCTCGAGAACGCTGAACAGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-239s1c1
Sequence:CCGGGCCGAATCCCAAGAACCATATCTCGAGATATGGTTCTTGGGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005850
ZNF835 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 835
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-1275s1c1
Sequence:CCGGCTCGCTTATAGAGCACCAGAACTCGAGTTCTGGTGCTCTATAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-436s1c1
Sequence:CCGGGCGTTCATCTTACACCAGAGACTCGAGTCTCTGGTGTAAGATGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-103s1c1
Sequence:CCGGGAGTTGGAAGGAAACTGGAAACTCGAGTTTCCAGTTTCCTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-420s1c1
Sequence:CCGGCTTCAGCTACTGTTCAGCGTTCTCGAGAACGCTGAACAGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005850.1-239s1c1
Sequence:CCGGGCCGAATCCCAAGAACCATATCTCGAGATATGGTTCTTGGGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks