EMAIL THIS PAGE TO A FRIEND

ZNF836

zinc finger protein 836

UniProtKB ID: Q6ZNA1
Gene ID:
dog(486429) zinc finger protein 135-like
cow(508131) zinc finger protein 836
cow(100140456) zinc finger protein 836
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102657 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102657 Rosetta Predictions human pricing
XM_091886 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323460 predicted 1705
2 SASI_Hs02_00323461 predicted 748
3 SASI_Hs02_00323462 predicted 2787
4 SASI_Hs02_00323463 predicted 1022
5 SASI_Hs02_00323464 predicted 1840
6 SASI_Hs02_00323465 predicted 1066
7 SASI_Hs02_00323466 predicted 2224
8 SASI_Hs02_00323467 predicted 2203
9 SASI_Hs02_00323468 predicted 3050
10 SASI_Hs02_00323469 predicted 2870
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_091886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249029 predicted 2529
2 SASI_Hs01_00249030 predicted 1684
3 SASI_Hs01_00249031 predicted 906
4 SASI_Hs01_00249032 predicted 2933
5 SASI_Hs01_00249033 predicted 1012
6 SASI_Hs01_00249034 predicted 1181
7 SASI_Hs01_00249035 predicted 3020
8 SASI_Hs01_00249036 predicted 2849
9 SASI_Hs01_00249037 predicted 1195
10 SASI_Hs01_00249038 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102657
ZNF836 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 836
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2962s21c1
Sequence:CCGGGCCTTTAGAGTGCGTTCAATTCTCGAGAATTGAACGCACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2057s21c1
Sequence:GTACCGGTACTCACTCGACATAAGATAACTCGAGTTATCTTATGTCGAGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-852s21c1
Sequence:CCGGAGAAGTGCCAATGACCTATAACTCGAGTTATAGGTCATTGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2094s21c1
Sequence:CCGGACGTTACCAATGCGGTGAATGCTCGAGCATTCACCGCATTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2899s21c1
Sequence:CCGGCTAGCACGTCATCGGAGTATTCTCGAGAATACTCCGATGACGTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102657
ZNF836 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 836
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2962s21c1
Sequence:CCGGGCCTTTAGAGTGCGTTCAATTCTCGAGAATTGAACGCACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2057s21c1
Sequence:GTACCGGTACTCACTCGACATAAGATAACTCGAGTTATCTTATGTCGAGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-852s21c1
Sequence:CCGGAGAAGTGCCAATGACCTATAACTCGAGTTATAGGTCATTGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2094s21c1
Sequence:CCGGACGTTACCAATGCGGTGAATGCTCGAGCATTCACCGCATTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2899s21c1
Sequence:CCGGCTAGCACGTCATCGGAGTATTCTCGAGAATACTCCGATGACGTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102657
ZNF836 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 836
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2962s21c1
Sequence:CCGGGCCTTTAGAGTGCGTTCAATTCTCGAGAATTGAACGCACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2057s21c1
Sequence:GTACCGGTACTCACTCGACATAAGATAACTCGAGTTATCTTATGTCGAGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-852s21c1
Sequence:CCGGAGAAGTGCCAATGACCTATAACTCGAGTTATAGGTCATTGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2094s21c1
Sequence:CCGGACGTTACCAATGCGGTGAATGCTCGAGCATTCACCGCATTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102657.1-2899s21c1
Sequence:CCGGCTAGCACGTCATCGGAGTATTCTCGAGAATACTCCGATGACGTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks