EMAIL THIS PAGE TO A FRIEND

ZNF837

zinc finger protein 837

UniProtKB ID: Q96EG3
Gene ID:
dog(484230) zinc finger protein 837
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129730 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725760 Rosetta Predictions human pricing
XM_001725797 Rosetta Predictions human pricing
XM_001726206 Rosetta Predictions human pricing
XM_001726207 Rosetta Predictions human pricing
XM_375665 Rosetta Predictions human pricing
XM_938741 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469838 predicted 1891
2 SASI_Hs02_00469839 predicted 1158
3 SASI_Hs02_00469840 predicted 1732
4 SASI_Hs02_00469841 predicted 1895
5 SASI_Hs02_00469842 predicted 1432
6 SASI_Hs02_00469843 predicted 1930
7 SASI_Hs02_00469844 predicted 1555
8 SASI_Hs02_00469845 predicted 1639
9 SASI_Hs02_00469846 predicted 1893
10 SASI_Hs02_00469847 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470041 predicted 1153
2 SASI_Hs02_00470042 predicted 1422
3 SASI_Hs02_00470043 predicted 1550
4 SASI_Hs02_00470044 predicted 1634
5 SASI_Hs02_00470045 predicted 715
6 SASI_Hs02_00470046 predicted 692
7 SASI_Hs02_00470047 predicted 1414
8 SASI_Hs02_00470048 predicted 1025
9 SASI_Hs02_00470049 predicted 1455
10 SASI_Hs02_00470050 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472728 predicted 1889
2 SASI_Hs02_00472729 predicted 1160
3 SASI_Hs02_00472730 predicted 1734
4 SASI_Hs02_00472731 predicted 1889
5 SASI_Hs02_00472732 predicted 1425
6 SASI_Hs02_00472733 predicted 1927
7 SASI_Hs02_00472734 predicted 1552
8 SASI_Hs02_00472735 predicted 1640
9 SASI_Hs02_00472736 predicted 1890
10 SASI_Hs02_00472737 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472738 predicted 1994
2 SASI_Hs02_00472739 predicted 1254
3 SASI_Hs02_00472740 predicted 1836
4 SASI_Hs02_00472741 predicted 1988
5 SASI_Hs02_00472742 predicted 1526
6 SASI_Hs02_00472743 predicted 2031
7 SASI_Hs02_00472744 predicted 1652
8 SASI_Hs02_00472745 predicted 1741
9 SASI_Hs02_00472746 predicted 1990
10 SASI_Hs02_00472747 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297366 predicted 1258
2 SASI_Hs01_00297369 predicted 1526
3 SASI_Hs01_00297373 predicted 1649
4 SASI_Hs01_00297374 predicted 1734
5 SASI_Hs02_00479704 predicted 817
6 SASI_Hs02_00479705 predicted 788
7 SASI_Hs02_00479706 predicted 1518
8 SASI_Hs02_00479707 predicted 1127
9 SASI_Hs02_00479708 predicted 1547
10 SASI_Hs02_00479709 predicted 1131
11 SASI_Hs01_00297365 predicted 1905
12 SASI_Hs01_00297367 predicted 1755
13 SASI_Hs01_00297368 predicted 1907
14 SASI_Hs01_00297370 predicted 1945
15 SASI_Hs01_00297371 predicted 1903
16 SASI_Hs01_00297372 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483259 predicted 2012
2 SASI_Hs02_00483260 predicted 1281
3 SASI_Hs02_00483261 predicted 1859
4 SASI_Hs02_00483262 predicted 2017
5 SASI_Hs02_00483263 predicted 1551
6 SASI_Hs02_00483264 predicted 2053
7 SASI_Hs02_00483265 predicted 1675
8 SASI_Hs02_00483266 predicted 1761
9 SASI_Hs02_00483267 predicted 2010
10 SASI_Hs02_00483268 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129730
ZNF837 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 837
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1129s21c1
Sequence:CCGGGACTGTACGCTTGCGACGAGTCTCGAGACTCGTCGCAAGCGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-615s21c1
Sequence:CCGGCAGAACCCTGAGCTGGTTATCCTCGAGGATAACCAGCTCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1522s21c1
Sequence:CCGGTCAACCAGCGCTCGAACCTGACTCGAGTCAGGTTCGAGCGCTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1066s21c1
Sequence:CCGGTGTGTCCTGAGTGCGGCCAAACTCGAGTTTGGCCGCACTCAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-796s21c1
Sequence:CCGGCTCAACTGTGTGAGGTCCACACTCGAGTGTGGACCTCACACAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129730
ZNF837 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 837
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1129s21c1
Sequence:CCGGGACTGTACGCTTGCGACGAGTCTCGAGACTCGTCGCAAGCGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-615s21c1
Sequence:CCGGCAGAACCCTGAGCTGGTTATCCTCGAGGATAACCAGCTCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1522s21c1
Sequence:CCGGTCAACCAGCGCTCGAACCTGACTCGAGTCAGGTTCGAGCGCTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1066s21c1
Sequence:CCGGTGTGTCCTGAGTGCGGCCAAACTCGAGTTTGGCCGCACTCAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-796s21c1
Sequence:CCGGCTCAACTGTGTGAGGTCCACACTCGAGTGTGGACCTCACACAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129730
ZNF837 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 837
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1129s21c1
Sequence:CCGGGACTGTACGCTTGCGACGAGTCTCGAGACTCGTCGCAAGCGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-615s21c1
Sequence:CCGGCAGAACCCTGAGCTGGTTATCCTCGAGGATAACCAGCTCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1522s21c1
Sequence:CCGGTCAACCAGCGCTCGAACCTGACTCGAGTCAGGTTCGAGCGCTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-1066s21c1
Sequence:CCGGTGTGTCCTGAGTGCGGCCAAACTCGAGTTTGGCCGCACTCAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129730.1-796s21c1
Sequence:CCGGCTCAACTGTGTGAGGTCCACACTCGAGTGTGGACCTCACACAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks